Mutagenesis, Vol. 14, No. 1, 31-36,
January 1999
© 1999 UK Environmental Mutagen Society/Oxford University Press
-Glutamyl transferase (GGT) deficiency in the GGTenu1 mouse results from a single point mutation that leads to a stop codon in the first coding exon of GGT mRNA
The Pulmonary Center, Boston University School of Medicine, 80 East Concord Street, R304, Boston, MA 02118 and 1 Department of Pediatrics, Department of Medical Genetics and The Waisman Center, University of Wisconsin, Madison, WI 53705, USA
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
GGTenu1, a recently described genetic murine model of
-glutamyl transferase (GGT) deficiency, was induced by the point mutagen N-ethyl-N-nitrosourea and is inherited as an autosomal recessive trait. The phenotype of systemic GGT deficiency suggested a mutation site within the cDNA coding region which is common in all GGT transcripts. To identify this site, total lung and kidney RNA was isolated from normal and mutant mice, amplified by RT–PCR using GGT-specific primers, cloned as two overlapping ~1 kb GGT cDNA fragments, sequenced and compared with that in the literature. A single base pair substitution was identified in the coding region at position 237, where thymidine became adenine, and this mutation replaced a leucine codon, TTG, with a termination codon, TAG. This mutation site was confirmed in mutant genomic DNA by PCR using primers that flanked the predicted site and spanned the intron between the common GGT non-coding exon and the first GGT coding exon. This PCR product was sequenced directly with the secondary 3' PCR primer, the mutation site identified and the protocol then utilized to genotype animals. In addition to this mutation, the steady-state level of GGT mRNA in mutant kidney is reduced 3-fold compared with the control. Heterodimeric GGT protein is not detectable by western blot in either whole kidney homogenate or a microsomal membrane fraction. The steady-state mRNA level of -glutatmyl cysteinyl synthetase was unchanged in mutant mice compared with normal, but that of heme oxygenase-1 and Cu,Zn-SOD was induced 4- and 3-fold, respectively. Hence, the GGTenu1 mouse model of GGT deficiency results from a single point mutation in the first coding exon of GGT mRNA and the resulting impairment in glutathione turnover induces oxidative stress in the kidney. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The GGTenu1 mouse is a genetic model of
-glutamyl transferase (GGT, EC 2.3.2.2) deficiency with an autosomal recessive mode of inheritance. Its glutathionuric phenotype was one of several aminoacidurias that was selected after mutagenesis of the murine genome with N-ethyl-N-nitrosourea (ENU) (Harding et al., 1997
). This model of GGT deficiency also exhibits glutathionemia, growth retardation, neurological abnormalities, infertility, cataract formation and premature mortality in common with the GGT null mutant mouse, GGTm1/GGTm1 (Lieberman et al., 1996). The two models differ in that not all GGTenu1 mice develop cataracts, they live almost twice as long and they do not develop plasma cysteine deficiency, presumably because of the persistence of a small residua of GGT activity. The exact site of the mutation that inactivated the GGT gene in the GGTenu1 mouse had not yet been defined.
GGT is a single copy gene in the rat and the mouse haploid genome and is regulated by multiple alternative promoters. Alternative GGT promoters are utilized by different tissues and result in GGT mRNAs with unique 5'-untranslated regions, but all encode the same protein (Lieberman et al., 1995). This protein is translated as a single chain propeptide, then modified by glycosylation and processed into a two-subunit heterodimer. GGT functions as a key enzyme in the metabolism of glutathione and glutathione-substituted molecules via the -glutamyl cycle (Tate and Meister, 1985).
We have previously characterized GGT gene expression in distal epithelial cells of developing, adult and oxidant-exposed rat lung (Joyce-Brady et al., 1994, 1996; Oakes et al., 1997; Takahashi et al., 1997). We sought to utilize GGTenu1 mice in order to gain further insight into the biology of GGT in lung, since controversy exists about its role in protecting the lung against oxidant injury. Hence, the availability of the GGTenu1 mouse, definition of its genetic alteration and developing a means of genotyping mice will be of considerable interest to lung cell biologists.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Materials and probes
Tri-Reagent (Molecular Research Center Inc., Cincinnati, OH) and QIAamp Tissue Kit (Qiagen, Germany) were used according to the manufacturers' protocols to isolate total RNA and genomic DNA, respectively. Electrophoresis grade agarose was from International Biotechnologies Inc. (New Haven, CT) and MetaphorTM agarose was purchased from FMC Bioproducts (Rockland, ME). DNA standards were from BRL. Materials for protein electrophoresis were from BioRad (Richmond, CA) and protein standards (mid range kit) were from Diversified Biotech (Newton Centre, MA). X-Omat film for radiography was from Eastman Kodak Co. (Rochester, NY). The radionuclides [
-32P]CTP (sp. act. 800 Ci/mmol) and [125I]protein A (sp. act. >30 µCi/µg) were obtained from ICN (Irvine, CA). A mouse GGT cDNA probe targeted to nucleotides within the coding domain was generated by PCR using the primers 5'-GGAGAGAGTTTCTGCCCATCCATAC (22M) and 5'-GCGGCTGGGTGGGTGGT (10M) and mouse kidney RNA as template. The 1200 bp PCR product was cloned into the pCRII vector (Invitrogen, San Diego, CA) and sequenced at the DNA/Protein Core Molecular Biology Unit of Boston University. The mouse cDNA probes for -glutamyl cysteine synthetase heavy chain (-GCS), heme oxygenase-1 (HO-1) and Cu,Zn superoxide dismutase (Cu,Zn-SOD) were generated by PCR. Primer design was based on the published cDNA sequences in the literature (Shibahara et al., 1985; Bewley, 1993; Kang et al., 1997). The ß-actin cDNA probe is described in Oakes et al. (1997). All probes were purified by agarose gel electrophoresis, recovered with the Compass kit (American Bioanalytical, Natick, MA) and radiolabeled with [-32P]CTP, random hexamers and Klenow DNA polymerase at 37°C for 2 h. The reaction was stopped with 0.5 M EDTA (pH 8) and the probe was recovered on a NucTrap purification column (Stratagene, La Jolla, CA) according to the manufacturer's guidelines. Rabbit antiserum raised against Triton-purified rat kidney GGT was kindly provided by R.P.Hughey (University of Pittsburgh) (Capraro and Hughey, 1983).
RT–PCR, subcloning and sequencing
Total RNA from lung and kidney was used for RT–PCR as described (Joyce-Brady et al., 1994). PCR primers were selected for primary and secondary PCR reactions: 12M, AGGCTTCCCGCAGCTTGGCGGTG; 11M, TGCGCTCCCTCTGTCCCACCC; M810, GAAACCGCAGACAGGTGAGCGGTGCCTCC; 10M, GGCGGCTGGGTGGGTGGT; M71, GAAGGCACTGACGTATCACCGTATCGTGGA; M72, GCCTTTCGGTTTGCCTATGCCAAGAGGAC. Each PCR reaction was performed for 20 cycles on an MJ Research thermal cycler. The PCR product was analyzed by agarose gel electrophoresis, eluted, cloned into pCR2.1 (TA Cloning Kit; Invitrogen, Carlsbad, CA) and sequenced at the DNA–Protein Core Facility at Boston University School of Medicine.
Genomic PCR
One hundred nanograms of DNA obtained from wild-type and GGTenu1 mouse lung were each analyzed by PCR. The respective upstream and downstream primers for primary and secondary PCR were GTTCAGGGAAGATCGGTCTCTGC (21M), GGGAGAGTTTCTGCCCATCCATAC (22M),CGTCCAATCTCTGAGCAGCGCTTGG (23M) and GCGCTTGGCGTCGGTGGCCACCGCC (24M). Primary PCR with 21M and 23M was performed for 20 cycles. One microliter from the primary PCR reaction was used in the secondary PCR along with 22M and 24M for 25 cycles. The PCR protocol was as follows: first step, 95°C for 3 min; first cycle, 95°C for 30 s, 65°C for 30 s, 72°C for 2 min; repeat for 19 or 24 cycles as above; a last step at 72°C for 5 min. The ~700 bp PCR product was analyzed on a 1% agarose gel, extracted and sequenced with primer 24M.
Mutation detection in genomic DNA by PCR and restriction enzyme digestion
Genomic DNA (100 ng) was prepared from tail biopsies and analyzed for the GGTenu1 mutation by a two-stage PCR reaction followed by NheI restriction. The final reaction conditions in a 50 µl total volume for both the primary and secondary PCR reactions were 10 mM Tris–HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2, 100 µM dNTPs, 0.8 µM each primer. The primary PCR reaction was performed using primers 21M and 23M for 30 cycles with the following thermocycler protocol: first step, 94°C for 3 min; first cycle, 94°C for 30 s, 60°C for 30 s, 72°C for 2 min; repeat for four cycles; sixth cycle, 94°C for 30 s, 63°C for 30 s, 72°C for 2 min; repeat for 24 cycles. The presence of an ~700 bp band was verified by 1% agarose gel electrophoresis. The products of the primary PCR reaction were diluted 10-fold with water and 2 µl diluted PCR product were used as the template for a secondary PCR reaction. The respective upstream and downstream primers for the secondary PCR reaction were CATCATCGGCCTCTGTATCTGCT (GGT1.54-NheI) and CGGTGGCCACCGCCGCCCTGG (GGT1.134). The primer GGT1.54-NheI contains a single base pair mismatch (in bold) and ends just 5' of the GGTenu1 mutation site in codon 26. Amplification of GGTenu1 mutant genomic DNA with these primers yields an 80 bp product which contains a novel NheI restriction site. The secondary PCR protocol was as follows: first step, 94°C for 3 min; first cycle, 94°C for 30 s, 57°C for 30 s, 72°C for 2 min; repeat for four cycles; sixth cycle, 94°C for 30 s, 62°C for 30 s, 72°C for 2 min; repeat for 29 cycles. Ten microliters of secondary PCR product were digested overnight with NheI enzyme and analyzed by 3% MetaphorTM agarose–1% standard agarose gel electrophoresis. NheI digestion of the 80 bp PCR product from GGTenu1 homozygous mice yields 60 and 20 bp fragments; the 80 bp wild-type PCR product is unaffected by NheI digestion.
RNA analysis
Total RNA obtained from kidney was quantitated by spectrophotometry and electrophoresed on a 1.0% agarose gel with 2.2 M formaldehyde in 1x MOPS, transferred to a HyBond membrane (Amersham, Arlington Heights, IL) in 20x SSC overnight (all at 23°C) and crosslinked with a Stratagene UV crosslinker. The membrane was prehybridized with QuickHyb (Stratagene) at 68°C for 15 min, after which radiolabeled probe was added and incubated for an additional 2 h. The filter was washed twice at room temperature with 2x SSC containing 0.1% SDS, twice more with 1x SSC containing 0.1% SDS at 60°C and dried. Absolute counts were measured on a Packard Instrument Image Analyzer (Downer's Grove, IL), then the filter was exposed to Kodak X-Omat film as described in Oakes et al. (1997).
Protein analysis
The kidneys were homogenized with a nylon pestle and solubilized in 10 mM Tris buffer (pH 8.0) containing 0.5% sodium cholate, 0.2 mM phenylmethylsulfonyl fluoride, 3 µg/ml leupeptin for 1 h. Insoluble material was sedimented by centrifugation at 10 000 g for 15 min and soluble protein was measured with the BioRad protein assay using bovine serum albumin as the standard. Total protein was separated by electrophoresis in a 15% SDS–polyacrylamide gel under reducing conditions. Proteins were electroblotted to a nitrocellulose membrane (Schleicher & Schuell, Keene, NH). The membrane was blocked with 5% Carnation dried milk in Dulbecco's phosphate-buffered saline, washed three times with 0.05% Tween 20 in Dulbecco's phosphate-buffered saline and probed for 1 h at room temperature with a 1:200 dilution of a rabbit anti-rat GGT immune serum. The membrane was washed again three times, probed with a 1:1000 dilution of [125I]protein A, dried and exposed to film with an intensifying screen for 72 h as described in Joyce-Brady et al. (1994).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Sequence of GGTenu1 cDNA
The similar phenotypes of GGTenu1 and GGTm1/GGTm1 mice suggested that both models exhibited a systemic deficiency of GGT activity. Even though there are at least seven GGT mRNA transcripts expressed from this multipromoter murine gene, all share the same coding domain (Lieberman et al., 1995
) and hence this region was analyzed first for the presence of ENU-induced point mutations in the GGT gene. GGT cDNA was produced from lung and kidney RNA of wild-type and mutant mice, cloned as two overlapping fragments and sequenced as described in Materials and methods. Wild-type cDNA sequences from both organs agreed exactly with that previously published (Shi,Z.-Z. et al., 1995). The GGTenu1 cDNA sequence from both lung and kidney was identical to the wild-type sequence except at codon 26, which lies in the first coding exon. Here the thymidine residue at the second position was replaced by adenine and this single nucleotide substitution mutated a leucine codon (TTG) into a stop codon (TAG). The GGTenu1 cDNA encodes only the first 25 amino acid residues of wild-type GGT protein. This severely truncated oligopeptide lacks all of the amino acid residues that are required for GGT enzyme activity (Figure 1).
|
Confirmation of the mutation in genomic DNA and genotyping strategy
Genomic DNA was analyzed in order to confirm the cDNA mutation. Primary and internal PCR primers were selected that flanked the mutation site and spanned an intron. The 5' PCR primers were located upstream of an intron in the common non-coding exon I and the 3' primers were located in the first coding exon downstream of the point mutation. Genomic DNA was isolated from GGTenu1 and wild-type lung and used in a primary and secondary PCR reaction as described in Materials and methods. The 700 bp PCR product was identified by agarose gel electrophoresis, isolated and directly sequenced using the internal 3' PCR primer. A thymidine nucleotide was identified in wild-type DNA and an adenine nucleotide was present in mutant GGTenu1 DNA, confirming the GGT cDNA mutation (Figure 2
).
|
This strategy was used to genotype animals by directly sequencing the PCR product (Gibbs et al., 1989
). An alternative strategy was devised using restriction enzyme analysis as described in Materials and methods. Use of PCR primer GGT1.54-Nhe I, which has a 1 bp mismatch near the 3'-end, introduces an NheI site into the secondary PCR product only in the presence of the mutation site. Digestion of the PCR product with this enzyme prior to separation by agarose gel electrophoresis yields a band of 60 bp in mutants and 80 bp in wild-type animals. Both products are present in GGTenu1 heterozygotes (Figure 3).
|
Expression of GGT mRNA and protein in GGTenu1 kidney
The presence of the cDNA mutation leads to a major inactivation of GGT protein expression, but a small residual amount of GGT activity is detectable in GGTenu1 kidney (Harding et al., 1997
). The effect that this mutation might have on expression of GGT mRNA was not then known and was determined by northern blot with total RNA isolated from kidneys of wild-type and mutant mice. Since the kidney expresses several GGT mRNA transcripts, the cDNA probe contained sequences only from the common coding domain, which should hybridize equally well to all GGT mRNA transcripts. A GGT signal was readily apparent in wild-type control kidney, but the signal in mutant kidney was reduced 3-fold when compared with ß-actin mRNA (Figure 4A).
|
GGT protein expression was examined in whole organ extracts from kidney, since this protein is most abundant in this organ. The GGT antiserum was raised against the Triton-soluble form of rat kidney GGT protein. Bands for the heavy (H) and light (L) chains of GGT heterodimer and high molecular weight heavy chain homodimers (HMW) are present in control wild-type rat kidney samples. The heavy chain is more immunoreactive than the light chain, as noted previously (Capraro and Hughey, 1983
; Joyce-Brady et al., 1994; Oakes et al., 1997). Similar bands are present in wild-type mouse kidney extract and mouse GGT heavy chain is also more immunoreactive than light chain. No signals are evident in GGTenu1 mutant extract (Figure 4B
).
Effect of GGTenu1 phenotype on expression of other mRNAs
Since glutathione metabolism plays a major role in cysteine supply and antioxidant defense, we compared the levels of three other antioxidant genes in the kidney of mutant versus normal mice. The steady-state mRNA level for the heavy chain of -GCS, the rate limiting enzyme in glutathione synthesis, was unchanged in mutants when adjusted for RNA loading. In contrast, the steady-state mRNA level of Cu,Zn-SOD was increased 3-fold and that of HO-1 4-fold (Figure 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The GGTenu1 mouse was one of several aminoaciduric phenotypes that was selected after mutagenesis of the murine genome with ENU (Harding et al., 1997
). ENU is a direct acting alkylating agent and a very potent mutagen in mouse (Russell et al., 1979). It produces mainly GC
AT transitions and, to a smaller extent, ATGC, ATCG, ATTA, GCCG and GCTA base substitutions (Shibuya and Morimoto, 1993). It has been used repeatedly to induce high frequency random germline point mutations from which animal models of human inborn errors of metabolism have been selected. This technique has demonstrated the ability of random mutagenesis to complement the emergent power of targeted mutagenesis in the mouse genome (Shedlovsky et al., 1993).
In addition to glutathionuria, the GGTenu1 phenotype includes glutathionemia, growth retardation, neurological abnormalities, infertility, early mortality and cataracts. These physical characteristics correlate closely with that of the GGT null mutant mouse (Lieberman et al., 1996). The autosomal recessive mode of inheritance in GGTenu1 suggests the presence of a mutation at a single genetic locus, and the maintenance of this phenotype through at least 12 generations of the original ENU-treated mouse supports this hypothesis, although the nature and the site of the mutation have not yet been identified. Efforts to establish breeding colonies of GGTenu1 mice have been hampered by the infertility of the homozygous state and the inability to detect carriers except by their production of glutathionuric progeny. Identification of a point mutation in the murine GGT gene would confirm the mutated site in this gene and provide a genotyping strategy.
GGT is a single copy gene in the rodent haploid genome and is regulated by multiple alternative promoters (Lieberman et al., 1995). These promoters are utilized in a tissue-specific fashion and transcribe multiple mRNAs, each of which contains a unique 5'-untranslated region, but all encode the same protein. The phenotype of the GGTenu1 mouse indicates a widespread deficiency of GGT activity, like that of the null mutant. Our studies have now identified a point mutation in the first coding exon of this gene. The mutation, an ATTA transversion, replaces a leucine codon (TTG) with a stop codon (TAG). Hence, GGT protein synthesis is prematurely terminated and the absence of any amino acids beyond the first 25 residues precludes any GGT enzyme activity in the severely truncated oligopeptide. We suspect that the small residua of GGT activity could result from the utilization of an internal methionine at codon 117, which is also preceded by a Kozak consensus sequence, as a translation initiation site, and in vitro transcription/translation studies support this hypothesis (data not shown). Protein abundance must be very low, as no GGT signal is detectable by western analysis in kidney extracts and GGT activity is only detectable with a sensitive enzymatic assay, which agrees with the original observation about this loss-of-function GGT mutation (Harding et al., 1997). The identification of this mutation site in genomic DNA confirms the cDNA mutation and allows one to identify heterozygotes genetically, thereby simplifying the production and maintenance of colonies of GGTenu1 mice.
In addition to the presence of this point mutation in GGT cDNA, the GGTenu1 mouse also exhibits a secondary reduction in the steady-state level of kidney GGT mRNA. This is not an unexpected observation, as mutations that introduce premature translation termination codons into the protein coding regions of genes are known to be associated with a low RNA phenotype. This has been noted with nonsense mutations in the genes for murine ß-spectrin (Bloom et al., 1994), human ß-glucuronidase (Sands and Birkenmeier, 1993), human ß-globin (Baserga and Benz, 1988), Chinese hamster dehydrofolate reductase (dhfr; Urlaub et al., 1989) and adenine phosphoribosyltransferase (aprt; Kessler and Chasin, 1996). This nonsense-mediated mRNA reduction results from destabilization of mutant mRNA in both the nucleus and the cytoplasm, although the exact mechanisms remain obscure (Urlaub et al., 1989; Kessler and Chasin, 1996). Hence, the premature termination codon induced by ENU and the secondary induction of a low GGT mRNA phenotype together likely account for the severe deficiency of GGT protein and activity.
Extracellular GGT-mediated glutathione metabolism supplies cysteine for intracellular glutathione synthesis and, in this regard, GGT functions in antioxidant defense. Impairment of extracellular glutathione turnover, induced by GGT deficiency, may reduce cysteine supply and compromise intracellular glutathione levels, thereby inducing oxidative stress. Since the kidney exhibits the highest GGT activity of any organ, we examined the GGTenu1 kidney for evidence of oxidative stress. This was accomplished by analyzing the mRNA level of HO-1 and Cu,Zn-SOD, as these antioxidant genes are inducible in the oxidant stressed kidney, the former in response to ischemia/reperfusion (Maines et al., 1993) and the latter during experimentally induced diabetes mellitus (Sechi et al., 1997), as well as that of -GCS heavy chain, which is induced by glutathione depletion (Shi,M.M. et al., 1994). -GCS heavy chain mRNA was unchanged, but both HO-1 and Cu,Zn-SOD mRNA levels were induced in the GGTenu1 kidney. This suggests that oxidative stress is probably occurring in a subpopulation of renal cells and the most likely site is the epithelium of the proximal tubule. This is a site of intense renal glutathione export and recycling (Scott and Curthoys, 1987), as GGT expression is restricted to these cells and is abundant (Lebargy et al., 1990). In situ hybridization analysis, using probes for HO-1 and Cu,Zn-SOD, could confirm this hypothesis. If glutathione export exceeds synthetic capability, then glutathione deficiency could cause a change in the intracellular redox state specifically in these cells. While the normal plasma cysteine levels in GGTenu1 mice suggest an adequate cysteine supply, the reduced urinary excretion of taurine, a cysteine metabolite, suggests a relative deficiency of cysteine or other sulfur-containing amino acids (Harding et al., 1997) and this could compromise intracellular glutathione synthesis. Alternatively, an inability to recycle glutathione at the cell surface could compromise control of the local redox environment at the plasma membrane and lead to activation of a redox-sensitive membrane protein (Kaul et al., 1998). Dietary N-acetylcysteine supplementation should be able to differentiate between these two mechanisms, but in either case, activation of intracellular redox-regulated signal transduction pathways could mediate the observed changes in antioxidant gene expression (Camhi et al., 1995; Suzuki et al., 1997).
In this paper we have now characterized a point mutation in the coding domain of the murine GGT gene in the GGTenu1 model of GGT deficiency. This model, together with the null mutant mouse model, will undoubtedly provide new information about the role of GGT-mediated glutathione metabolism in mammalian physiology. We are particularly interested in the role of GGT in the lung. We have identified GGT gene expression in alveolar epithelial type 2 cells, T2 cells and bronchiolar epithelial Clara cells (Joyce-Brady et al., 1994), although the T2 level of GGT mRNA expression is much lower than that of the Clara cell and the two cells appear to synthesize different forms of GGT protein (Oakes et al., 1997). Furthermore, we have shown that the GGT gene is developmentally regulated in these two epithelial cell types. The alveolar T2 cell alone expresses GGT in late fetal and early post-natal lung, perhaps making the neonatal lung particularly susceptible to oxidative stress. Lastly, GGT mRNA is induced in the lung and protein accumulates in lung surfactant when adult rats are exposed to an inhaled oxidant stress (Takahashi et al., 1997). We believe that the alternative GGT promoters, at least three of which are active in fetal type 2 cells but differentially regulated by oxygen at birth (Joyce-Brady et al., 1996), function to maintain type 2 cell GGT expression over a wide range of oxygen concentrations and that in its absence, the gas exchange surface of the lung will be more susceptible to injury by hyperoxia. The GGTenu1 mouse will now provide a model to test this hypothesis directly by analyzing lung function in newborn and adult GGTenu1 mice exposed to different oxygen environments and thereby define the biological role of lung epithelial cell GGT expression.
|
Notes |
|---|
2 To whom correspondence should be addressed. Tel: +1 617 638 4860; Fax: +1 617 536 8093; Email: mjbrady{at}bupula.bu.edu
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
-
Baserga,S.J. and Benz,E.J.,Jr (1988) Nonsense mutations in the human beta-globin gene affect mRNA metabolism. Proc. Natl Acad. Sci. USA, 85, 2056–2060.
Bewley,G.C. (1993) cDNA and deduced amino acid sequence of murine Cu-Zn superoxide dismutase. Nucleic Acids Res., 16, 2728.
Bloom,M.L., Kaysser,T.M., Birkenmeier,C.S. and Barker,J.E. (1994) The murine mutation jaundiced is caused by replacement of an arginine with a stop codon in the mRNA encoding the ninth repeat of beta-spectrin. Proc. Natl Acad. Sci. USA, 91, 10099–10102.
Camhi,S.L., Lee,P. and Chio,A.M. (1995) The oxidative stress response. New Horizons, 3, 170–182.[Medline]
Capraro,M.A. and Hughey,R.P. (1983) Processing of the propeptide form of rat renal gamma-glutamyltranspeptidase. FEBS Lett., 157, 139–143.[ISI][Medline]
Gibbs,R.A., Nguyen,P.N., McBride,L.J., Koepf,S.M. and Caskey,C.T. (1989) Identification of mutations leading to the Lesch–Nyhan syndrome by automated direct DNA sequencing of in vitro amplified cDNA. Proc. Natl Acad. Sci. USA, 86, 1919–1923.
Harding,C.O., Williams,P., Wagner,E., Chang,D.S., Wild,K., Colwell,R.E. and Wolff,J.A. (1997) Mice with genetic gamma-glutamyl transpeptidase deficiency exhibit glutathionuria, severe growth failure, reduced life spans and infertility. J. Biol. Chem., 272, 12560–12567.
Joyce-Brady,M., Takahashi,Y., Oakes,S.M., Rishi,A.K., Levine,R.A., Kinlough,C.L. and Hughey,R.P. (1994) Synthesis and release of amphipathic -glutamyl transferase by the pulmonary alveolar type 2 cell. J. Biol. Chem., 269, 14219–14226.
Joyce-Brady,M., Oakes,S.M., Wuthrich,D. and Laperche,Y. (1996) Three alternative promoters of the rat gamma-glutamyl transferase gene are active in developing lung and are differentially regulated by oxygen after birth. J. Clin. Invest., 97, 1774–1779.[ISI][Medline]
Kang,Y., Oiao,X., Jurma,O., Knusel,B. and Anderson,J.K. (1997) Cloning/brain localization of mouse glutamylcysteine synthetase heavy chain mRNA. Neuroreport, 8, 2053–2060.[ISI][Medline]
Kaul,N., Choi,J. and Forman,H.J. (1998) Transmembrane redox signaling activates NF-kappaB in macrophages. Free Radic. Biol. Med., 24, 202–207.[ISI][Medline]
Kessler,O. and Chasin,L.A. (1996) Effects of nonsense mutations on nuclear and cytoplasmic adenine phosphoribosyltransferase RNA. Mol. Cell. Biol., 16, 4426–4435.[Abstract]
Lebargy,F., Bulle,F., Siegrist,S., Guellaen,G. and Bernaudin,J.-F. (1990) Localization by in situ hybridization of -glutamyl transpeptidase mRNA in the rat kidney using 35S-labeled RNA probes. Lab. Invest., 62, 731–735.[ISI][Medline]
Lieberman,M.W., Barrios,R., Carter,B.Z., Habib,G.M., Lebovitz,R.M., Rajagopalan,S., Sepulveda,A.R., Shi,Z.-Z. and Wan,D.-F. (1995) Gamma-glutamyl transpeptidase: what does the organization and expression of a multipromoter gene tell us about its function? Am. J. Pathol., 147, 1175–1185.[Abstract]
Lieberman,M.W., Wiseman,A.L., Shi,Z., Carter,B.Z., Barrios,R., Ou,C., Chevez-Barrios,P., Wang,Y., Habib,G.M., Goodman,J.C. et al. (1996) Growth retardation and cysteine deficiency in -glutamyl transpeptidase-deficient mice. Proc. Natl Acad. Sci. USA, 93, 7923–7926.
Maines,M.D., Mayer,R.D., Ewing,J.F. and McCoubrey,W.K.,Jr (1993) Induction of kidney heme oxygenase-1 (HSP32) mRNA and protein by ischemia–reperfusion: possible role of heme as both promoter of tissue damage and regulator of HSP32. J. Pharmacol. Exp. Ther., 264, 457–462.
Oakes,S.M., Takahashi,Y., Williams,M.C. and Joyce-Brady,M. (1997) Ontogeny of gamma-glutamyltransferase in the rat lung. Am. J. Physiol., 272, L739–L744.
Russell,W.L., Kelly,E.M., Hunsicker,P.R., Bangham,J.W., Maddux,S.C. and Phipps,E.L. (1979) Specific-locus test shows ethylnitrosourea to be the most potent mutagen in the mouse. Proc. Natl Acad. Sci. USA, 76, 5818–5819.
Sands,M.S. and Birkenmeier,E.H. (1993) A single-base-pair deletion in the ß-glucuronidase gene accounts for the phenotype of murine mucopolysaccharidosis type VII. Proc. Natl Acad. Sci. USA, 90, 6567–6571.
Scott,R.D. and Curthoys,N.P. (1987) Renal clearance of glutathione measured in rats pretreated with inhibitors of glutathione metabolism. Am. J. Physiol., 252, F877–F882.
Sechi,L.A., Ceriello,A., Griffin,C.A., Catena,C., Amstad,P., Schambelan,M. and Bartoli,E. (1997) Renal antioxidant enzyme mRNA levels are increased in rats with experimental diabetes mellitus. Diabetologia, 40, 23–29.[ISI][Medline]
Shedlovsky,A., McDonald,J.D., Symula,D. and Dove,W.F. (1993) Mouse models of human phenylketonuria. Genetics, 134, 1205–1210.[Abstract]
Shi,M.M., Kugelman,A., Iwamoto,T., Tian,L. and Forman,H.J. (1994) Quinone-induced oxidative stress elevates glutathione and induces gamma-glutamylcysteine synthetase activity in rat lung epithelial L2 cells. J. Biol. Chem., 269, 26512–26517.
Shi,Z.-Z., Habib,G.M., Lebovitz,R.M. and Lieberman,M.W. (1995) Cloning of cDNA and genomic structure of the mouse -glutamyl transpeptidase-encoding gene. Gene, 167, 233–237.[ISI][Medline]
Shibahara,S., Muller,R., Taguchi,H. and Yoshida,T. (1985) Cloning and expression of cDNA for rat heme oxygenase. Proc. Natl Acad. Sci. USA, 82, 7865–7869.
Shibuya,T. and Morimoto,K. (1993) A review of the genotoxicity of 1-ethyl-1-nitrosourea. Mutat. Res., 297, 3–38.[ISI][Medline]
Suzuki,Y.J., Forman,H.J. and Sevanian,A. (1997) Oxidants as stimulators of signal transduction. Free Radic. Biol. Med., 22, 269–285.[ISI][Medline]
Takahashi,Y., Oakes,S.M., Williams,M.C., Takahashi,S., Miura,T. and Joyce-Brady,M. (1997) Nitrogen dioxide exposure activates gamma-glutamyl transferase gene expression in rat lung. Toxicol. Appl. Pharmacol., 143, 388–396.[ISI][Medline]
Tate,S. and Meister,A. (1985) Gamma-glutamyl transpeptidase from kidney. Methods Enzymol., 113, 400–419.[ISI][Medline]
Urlaub,G., Mitchell,P.J., Ciudad,C.J. and Chasin,L.A. (1989) Nonsense mutations in the dihydrofolate reductase gene affect RNA processing. Mol. Cell. Biol., 9, 2868–2880.
Received on February 18, 1998; accepted on June 8, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  M. H. Lowry, B. P. McAllister, J.-C. Jean, L. A. S. Brown, R. P. Hughey, W. W. Cruikshank, S. Amar, E. C. Lucey, K. Braun, P. Johnson, et al. Lung Lining Fluid Glutathione Attenuates IL-13-Induced Asthma Am. J. Respir. Cell Mol. Biol., May 1, 2008; 38(5): 509 - 516. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Jean, Y. Liu, L. A. Brown, R. E. Marc, E. Klings, and M. Joyce-Brady gamma -Glutamyl transferase deficiency results in lung oxidant stress in normoxia Am J Physiol Lung Cell Mol Physiol, October 1, 2002; 283(4): L766 - L776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Joyce-Brady, J.-C. Jean, and R. P. Hughey gamma -Glutamyltransferase and Its Isoform Mediate an Endoplasmic Reticulum Stress Response J. Biol. Chem., March 16, 2001; 276(12): 9468 - 9477. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||