Mutagenesis vol. 19 no. 4 pp. 269-276,
July 2004
© 2004 UK Environmental Mutagen Society/Oxford University Press
DNA damage and repair measured in different genomic regions using the comet assay with fluorescent in situ hybridization
inská21Cancer Research Institute, Vlárska 7, 833 91 Bratislava, Slovakia, 2Institute of Preventive and Clinical Medicine, Slovak Medical University, Limbová 12, 833 03 Bratislava, Slovakia, 3Department of Nutrition, University of Oslo, PO Box 1046, Blindern, 0316 Oslo, Norway and 4Rowett Research Institute, Greenburn Road, Aberdeen AB21 9SB, UK
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The comet assay is a sensitive method for measuring DNA strand breaks in eukaryotic cells. After embedding in agarose, cells are lysed and electrophoresed at high pH. DNA loops containing breaks (in which supercoiling is relaxed) escape from the nucleoid comet head to form a tail. Oligonucleotide probes were designed for 5' and 3' regions of the genes for dihydrofolate reductase (DHFR) and O6-methylguanine DNA methyltransferase (MGMT), both from the Chinese hamster, and the human tumour suppressor p53 gene. Alternate ends were labelled with either biotin or fluorescein. These probes were hybridized to the DNA of comets from Chinese hamster ovary (CHO) cells or human lymphocytes treated with H2O2 or photosensitizer plus light to induce oxidative damage. Amplification with Texas red- and fluorescein-tagged antibodies led, in the case of p53 in human cells, to red and green signals located in the comet tail (as well as in the head), indicating the presence of breaks in the vicinity of the gene. However, only one end of the MGMT gene appeared in the tail and almost no signals from the DHFR gene, either red or green, were in the tail of comets from CHO cells. Restriction on movement from the head to tail may result from the presence of a ‘matrix-associated region’ in the gene. The kinetics of repair of oxidative damage were followed; strand breaks in the p53 gene were repaired more rapidly than total DNA. Thus, fluorescent in situ hybridization in combination with the comet assay provides a powerful method for studying repair of specific genes in relation to chromatin structure.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Not all mammalian genes are repaired with the same efficiency. Following damage by UV radiation, cyclobutane pyrimidine dimers in transcribed genes tend to be repaired more quickly compared with damage in non-transcribed genes (Bohr et al., 1985
; Madhani et al., 1986; Mellon et al., 1986) and damage is removed more quickly from the transcribed than from the non-transcribed strand (Mellon et al., 1987). This phenomenon is known as transcription-coupled repair (TCR). The approach generally used to measure gene-specific repair is based on digestion of DNA extracted from UV-treated cells with a suitable restriction endonuclease and a UV damage-specific endonuclease, followed by denaturation, electrophoretic separation and identification of the restriction fragment by Southern blotting using a radioactively labelled probe. If sufficient damage is present so that virtually all copies of the gene fragment contain a lesion, a smear rather than a discrete band appears on the autoradiograph, because the lesions (and hence the endonuclease-induced breaks) are randomly distributed. When cells are incubated after damage, intact restriction fragments begin to reappear as the damage is repaired, and the band increases in intensity. Such experiments require a high degree of damage, to ensure that virtually all cells are damaged in the fragment of interest. The relevance of the results to the normal situation of low levels of damage from environmental exposure is uncertain. Relatively few genes have been subjected to this kind of analysis of repair of UV damage and only recently has gene-specific repair been investigated in relation to other kinds of damage, such as base oxidation (Taffe et al., 1996; LePage et al., 2000).
The comet assay (single cell gel electrophoresis) is a sensitive method for detecting DNA strand breaks and other lesions (Collins and Duinská, 2002). Cells embedded in agarose on a microscope slide are lysed with non-ionic detergent and 2.5 M NaCl, a treatment known for many years to produce nucleoids, structures resembling nuclei but lacking most histones and other nuclear proteins (Cook et al., 1976). A nuclear matrix or scaffold is still present, supporting the DNA as a series of loops, which are supercoiled by virtue of their former turns around nucleosomes. If breaks are present, supercoiling is relaxed and the DNA loops are able to extend to form a halo (Cook et al., 1976). In the comet assay, the nucleoids are immobilized in agarose and electrophoresed. The DNA extends towards the anode to form a comet tail, which is visualized by fluorescence microscopy after staining with a dye such as 4',6-diamidino-2-phenylindole (DAPI). Increasing the number of breaks increases the percentage of DNA in the tail, but has little effect on tail length, supporting the notion that, as in nucleoid halos, the factor determining the appearance of DNA in the tail is whether or not the loop is relaxed (Collins et al., 1997).
With its high sensitivity, the comet assay lends itself to investigations of the kinetics of repair of low levels of damage induced in nuclear DNA by treatment with reactive oxygen, e.g. H2O2. Strand breaks are typically rejoined quickly. In Chinese hamster ovary (CHO) cells, most breaks disappear during incubation for 30 min (Collins and Horváthová, 2001), very similar to the rate of repair of ionising radiation-induced strand breaks (Frankenberg-Schwager, 1989). Freshly isolated human lymphocytes apparently rejoin H2O2-induced breaks more slowly (Collins et al., 1995). Oxidized bases can also be detected with the comet assay, by incubating the nucleoids in the gel with a lesion-specific endonuclease (endonuclease III or formamidopyrimidine DNA glycosylase, FPG) to convert the damage to breaks. Repair of oxidized bases in CHO cells or HeLa cells has a t0.5 of several hours (Collins et al., 1995; Collins and Horváthová, 2001).
We have developed a general method, combining the comet assay and fluorescent in situ hybridization (FISH), to monitor the repair of particular genes after low level DNA damage, against the background of total genomic DNA damage and repair. Oligonucleotide probes are used to identify the two ends of one strand of a target gene in the DNA of a comet. They are labelled with either biotin or fluorescein so that after amplification with appropriate antibodies and fluorescent tags, the two ends appear as red (Texas red) or green (fluorescein) spots against the DAPI-stained background.
We selected for study three genes known to be expressed in most cell types. The housekeeping gene for dihydrofolate reductase (DHFR) was the first gene investigated for efficiency of repair relative to the genome overall (Bohr et al., 1985). Unexpectedly, comet–FISH signals for DHFR do not appear in the tail even in comets from severely damaged CHO cells. In contrast, in human lymphocytes FISH clearly indicates DHFR genes (or pseudogenes) in the tail, and we have followed their repair, as well as repair of the O6-methylguanine DNA methyltransferase gene (MGMT) in CHO cells and the tumour suppressor protein gene p53 in human cells, in comparison with the rate of repair of DNA overall. This approach is generally applicable to measuring gene-specific repair rates. It also provides information on the location of individual genes in relation to the nuclear matrix and, hence, on the structural organization of DNA repair.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Cells
CHO cells were cultured in DMEM/F12 medium (Gibco BRL, Paisley, UK) with 10% foetal calf serum. Cells were washed twice with phosphate-buffered saline (PBS) and treated as described below with DNA-damaging agent.
Lymphocytes were obtained from finger-prick blood samples. A sample of 30 µl of blood was added to 1 ml of RPMI 1640 (without phenol red) and 10% foetal calf serum in a 1.5 ml Eppendorf tube and left on ice for 30 min before being underlayed with 0.1 ml of Histopaque 1077 (Sigma, Poole, UK). The tubes were centrifuged at 200 g for 3 min at 4°C. Lymphocytes were removed from just above the interface between the RPMI and Histopaque, mixed with 1 ml of PBS, centrifuged again and the pellet suspended in PBS containing H2O2 or photosensitizer (see below).
Treatment with DNA-damaging agent
CHO cells growing in monolayer and lymphocytes in suspension were treated in one of three ways. (i) Cells were incubated with 0.2 mM H2O2 in PBS for 5 min on ice. This treatment induces predominantly strand breaks in the DNA. (ii) The photosensitizer Ro 19-8022 (Hoffmann-La Roche, Basel, Switzerland) was added to the cells at 0.1 µM in PBS and the cells were irradiated for 2 min on ice at 0.33 m with a 1000 W tungsten halogen lamp. This treatment oxidizes bases in DNA but causes few direct strand breaks (Pflaum et al., 1998). (iii) CHO cells were irradiated with UVC (1 J/m2) to induce pyrimidine dimers. Before and after irradiation, they were incubated (in growth medium) with 2 mM hydroxyurea and 0.1 mM 1-ß-D-arabinofuranosylcytosine (araC) (Sigma) for 30 min at 37°C.
After treatment, CHO cells were removed from the culture dish by light trypsinization, centrifuged and suspended in PBS. Lymphocytes were centrifuged and resuspended in PBS. Concentrations of cells were adjusted so that, after a final centrifugation, the pellet could be taken up in 1% low melting point agarose (Gibco BRL) in PBS at 37°C to give 
2 x 104 cells in 85 µl.
The comet assay (single cell alkaline gel electrophoresis)
Plain glass microscope slides were precoated by dipping in a solution of 1% normal electrophoresis grade agarose (Gibco BRL) in distilled water and drying. Cells in 85 µl of agarose at 37°C were placed on a precoated slide followed by a glass coverslip. Gels were left to set at 4°C and then, after removing the coverslips, placed in lysis solution (2.5 M NaCl, 0.1 M Na2EDTA, 10 mM Tris brought to pH 10.0 with NaOH, plus 1% Triton X-100) for 1 h at 4°C. Slides with cells that had been treated with photosensitizer plus visible light to induce oxidized bases were washed three times for 5 min in enzyme buffer (40 mM HEPES, 0.1 M KCl, 0.5 mM EDTA, 0.2 mg/ml bovine serum albumin, pH 8.0 with KOH) and incubated for 30 min with FPG at 37°C. This converts 8-oxoguanine residues to strand breaks. All slides were then placed in an electrophoresis tank and immersed in 0.3 M NaOH, 1 mM Na2EDTA for 40 min, before electrophoresis at 25 V (0.8 V/cm) for 30 min at an ambient temperature of 4°C. After electrophoresis, slides were neutralized by washing three times for 5 min with 0.4 M Tris–HCl, pH 7.5. Comets were analysed for total DNA content by staining with DAPI (1 µg/ml) for fluorescence microscopy, using a CCD COHU solid state camera and image analysis software Komet 3.0 (Kinetic Imaging, Liverpool, UK).
Fluorescent in situ hybridization combined with comets
In parallel with the standard comet assay analysis, duplicate slides were prepared for FISH. Slides were immersed for 25–30 min in absolute ethanol at 4°C and then in 0.5 M NaOH for 25 min to ensure complete denaturation of DNA. Slides were dehydrated in 70, 80 and 95% ethanol for 5 min each.
Specific DNA probes were designed for coding sequences close to the 5'- and 3'-ends of the CHO DHFR gene, the CHO MGMT gene and the human p53 gene as follows (all purchased from Sigma-Genosys, Cambridge, UK). DHFR: exon 1, bases 38–63, 5'-AGAATATGGGCATCGGCAAGAACGGA, labelled 5' with biotin; exon 6, bases 533–558, 5'-ATAAATTTGAAGTC TATGAGAAGAAA, labelled 5' with fluorescein. MGMT: bases 8–33, 5'-AGACCTGCAAAATGAAATACACAGTG, labelled 5' with biotin; bases 463–488, 5'-AGTAACGGCAGCATTGGTAATTACTC, labelled 5' with fluorescein. p53: exon 2, bases 38–63, 5'-TCTGAGTCAGGAAACATT TTCAGACC, labelled 5' with biotin; exon 11, bases 38–63, 5'-ATAA AAAACTCATGTTCAAGACAGAA, labelled 5' with fluorescein.
Oligonucleotides as supplied (between 240 and 600 µg) were redissolved in 1 ml of TE buffer (10 mM Tris–HCl, pH 7.4, 1 mM EDTA) and 10 µl aliquots (stored at –20°C) diluted 150x in TE buffer for use. Equal volumes of the two probes for one gene were mixed, a total of 30 µl was pipetted onto each gel and covered with a plastic coverslip cut from overhead transparency film. Hybridization was performed at 37°C in a humid chamber for 72 h (88 h in the case of p53).
After hybridization, slides were washed in 2x SSC for 5 min at 42°C, in 50% 2x SSC/50% formamide (Sigma) for 5 min at 42°C, twice in 2x SSC for 5 min at room temperature and, finally, rinsed with 4x SSC/0.05% Tween 20 (Sigma). Development of immunofluorescent signals involved two cycles of an antibody cascade of Texas red–avidin DCS (A1) and biotinylated anti-avidin D (A2) (Vector Laboratories, Peterborough, UK), to detect biotin-labelled oligonucleotides, and rabbit anti-fluorescein (F1) and fluorescein-conjugated donkey anti-rabbit (F2) (Cambio, Cambridge, UK), to detect fluorescein-labelled oligonucleotides, as follows [dilutions in 4x SSC/0.05% Tween 20 with blocking protein (Cambio) at 15%]: (i) 30 µl A1 (1:400); (ii) 15 µl A2 (1:50) + 15 µl F1 (1:125), premixed; (iii) 15 µl A1 (1:200) + 15 µl F2 (1:250), premixed; (iv) 15 µl A2 (1:50) + 15 µl F1 (1:125), premixed; (v) 15 µl A1 (1:200) + 15 µl F2 (1:250), premixed. At each stage, slides were incubated for 30 min at 37°C in a humid box and between stages they were washed three times for 4 min in 4x SSC/0.05% Tween 20. After a final three washes they were air dried.
Slides were incubated for 10 min in distilled water before counterstaining with 30 µl of DAPI, diluted in H2O with Vectashield antifade mountant (Vector Laboratories). Fluorescence microscopy was performed at 63x magnification on a fluorescence microscope (Leica DMR, Wetzlar, Germany) equipped with filters for observation of DAPI (blue), Texas red (red) and fluorescein (green). Images were captured using a Hamamatsu colour chilled 3CCD camera linked to a computer. Image-Pro Plus version 4.0 (Media Cybernetics, Silver Spring, MD) was used to capture and process the images. Colour and contrast were adjusted using Photoshop (Adobe, San Jose, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The genes studied were: DHFR (Chinese hamster), length 31 kb, 564 bases expressed in six exons; MGMT (Chinese hamster), length 200 kb, 630 bases; p53 (human), length 20 kb, 2629 bases expressed in 11 exons.
Oligonucleotide probes were designed to be complementary to sequences in 5' and 3' terminal exons of each gene and end-labelled with biotin and fluorescein, respectively. After hybridization with comet DNA for 3 days or more at 37°C, as described in Materials and methods, oligonucleotides were detected by incubation with avidin–Texas red followed by biotinylated anti-avidin to reveal the biotin-labelled probes, and incubation with rabbit anti-fluorescein followed by fluorescein-conjugated donkey anti-rabbit antibodies to detect fluorescein-labelled probes.
Localization of the DHFR gene within comet DNA of CHO cells
CHO cells were treated with H2O2 to introduce DNA strand breaks, embedded in agarose on a microscope slide, lysed, treated with alkali and electrophoresed to produce ‘comets’. To estimate the extent of DNA damage, some slides were stained with DAPI for fluorescence microscopy. The percentage DNA in the tail of 50 randomly selected comets was estimated by computer image analysis. In a typical experiment, the H2O2 produces on average 50% DNA in the tail. Other slides were set up for hybridization with the specific oligonucleotides. These slides were counterstained with DAPI so that the red and green signals from the oligonucleotides could be visualized against the head or tail of the comets. Figure 1A shows a typical image, with red and green spots clearly visible. In almost all the comets examined, the spots were present only in the head of the comet. The average numbers of spots per comet are recorded in Table I. As a control, strand breaks were introduced in a different way, by irradiating CHO cells with UVC and incubating them with hydroxyurea and araC to block repair synthesis and accumulate incomplete repair sites as DNA breaks. A similar pattern of FISH signals exclusively in the comet head was recorded (Table I).
|
|
Localization and repair of the CHO MGMT gene
CHO cells were damaged either with H2O2 or with the photosensitizer Ro 19-8022 and visible light to induce oxidized bases and incubated for different times (depending on the type of damage) to allow repair. In the subsequent comet assay, those slides prepared from Ro 19-8022-treated cells were incubated with FPG to make breaks at sites of 8-oxoguanine. Thus the removal of damage (frank strand breaks or FPG-sensitive sites) was monitored by following the decrease in percent DNA in the tail with time of incubation (Figure 2, broken lines). H2O2-induced damage was repaired rapidly (Figure 2A, open squares); within 20 min almost all breaks were rejoined. Base excision repair is a slower process, as Figure 2B illustrates. Parallel slides from these experiments were hybridized with the oligonucleotide probes to the 5' and 3' terminal exons of the MGMT gene. In contrast to what was seen with the DHFR probes, signals now appeared over tail DNA, although these were predominantly green spots of fluorescein label; Texas red signals were mostly found in the head. Fifty comets were scored, recording the occurrence of Texas red and fluorescein signals in head and tail. These data are plotted in Figure 2 (solid lines) as percentages of red or green spots in the tail, so that the rate of repair of DNA containing the MGMT gene can be compared directly with that of total DNA. In the H2O2-treated cells, restoration of green spots to head DNA occurred as rapidly as the repair of total DNA (Figure 2A and Table I). After Ro 19-8022 + light treatment, it appears that repair of FPG-sensitive sites in the DNA containing MGMT is non-existent during the first hour and then rapid (Figure 2B and Table I).
|
Localization and repair of the DHFR gene in comets of human cells
The DHFR oligonucleotide probes made for hybridization with CHO DNA had sufficient homology to be used also in experiments with comets from human lymphocytes. In this case, hybridization signals appeared in both head and tail DNA (Figure 1B). To examine repair, cells were incubated for 4 h after both H2O2 and Ro 19-8022 + light treatment, since rejoining of strand breaks is known to be slower in lymphocytes than in cultured cells (Collins et al., 1995
), and Figure 3A confirms this; only about half of the strand breaks were repaired in that time. However, DNA containing the DHFR gene damaged with either agent is repaired completely in 4 h (Figure 3A and B and Table I).
|
Localization and repair of the human p53 gene
Finally, we examined damage and repair of DNA containing the p53 gene in human lymphocytes treated with H2O2. Red and green signals were almost equally distributed between the head and tail of comets from cells taken immediately after H2O2 treatment (Table I). After only 20 min incubation of cells to allow repair to occur, virtually all p53 probes were located in the comet heads, indicating complete repair, while total DNA had been repaired to only a small extent in that time (Figures 1C and 4 and Table I).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Comets with FISH
The combination of FISH with the comet assay was first reported by Santos et al. (1997
). Telomere- and centromere-specific probes were hybridized to the DNA of comets from human lymphocytes. In addition, Santos et al. probed three segments of the human MGMT gene, which typically appeared in a tandem array. McKelvey-Martin et al. (1998) hybridized p53 sequences as well as chromosome-specific probes. Applying 12 different chromosome painting probes to human lymphocyte comets, Rapp et al. (2000) investigated the differential sensitivity of DNA to breakage following UVA irradiation and found an inverse relationship between the density of active genes in the chromosome (as indicated by expressed sequence tags) and the level of DNA breakage. Our experiments were based on the following model.
(i) If two (red and green) spots appear in the head of a comet, this indicates that the gene is in an undamaged region of DNA.
(ii) The appearance of red and green signals in the tail of a comet indicates that a break has occurred in the proximity of the gene. According to our model of comet formation, supercoiling has been relaxed in the loop of DNA containing the gene.
(iii) In principle, if the distance between the two sites of hybridization is small relative to the length of the comet tail and the gene is found in the tail, it should be possible to determine whether breakage has occurred in the DNA between the sites (in which case the two spots would be separated by a distance greater than the distance separating them in intact DNA) or in the DNA of the loop enclosing the gene (in which case the normal separation would be seen). However, breakage between the probed points of the gene will then be a very rare event, since we are applying low levels of damage to a small target. In the present work, we have simply analysed whether the probe labels are in the head or tail of the comet and information we collect on relative damage and repair rates refers to the segment of DNA containing the gene and forming a unit of supercoiling and of comet tail structure.
It is useful at this point to relate the sizes of the genes studied here to the dimensions of the comet. The DHFR gene, at 31 kb, corresponds to an extended length of 10 µm. [The vertical rise per base pair in B form DNA is 3.38 Å. DNA in the comet head is double-stranded (Collins et al., 1997). In the tail, it is single-stranded, but it is not known whether it is fully extended or tangled.] The measured distance between red and green spots in Figure 1A is consistent with these dimensions. The diameter of the head of a comet from a moderately damaged cell is typically 20 µm and the length of a tail is 60 µm. p53 is smaller, while the MGMT gene is 6.5 times as long as the DHFR gene, and comparable with the length of the comet tail.
Distribution of gene-specific signals between head and tail
Neglecting possible differences in sensitivity of regions of DNA to damage, the probability that a particular gene will be in the tail should be a direct function of the number of DNA breaks present. Thus, if on average (in a population of comets) 50% of total DNA is in the tail, then we would expect 50% of the copies of a particular gene to be located in the tail. We were therefore initially surprised to find virtually no DHFR labels in the tails of CHO comets damaged with H2O2, nor when breaks were accumulated by allowing incision without ligation after UV irradiation. It is unlikely that the DHFR-containing DNA region is extraordinarily resistant to damage by these disparate agents. However, it is known that in CHO cells there is a scaffold- or matrix-associated region of DNA (SAR or MAR) in the middle of this gene (Kas and Chasin, 1987). SAR/MARs are identified by co-localization with the nuclear scaffold or matrix during isolation with high salt or lithium diiodosalicylate, respectively. They cannot be unequivocally identified on the basis of sequence consensus. In the comet assay, cells are lysed with high salt and Triton X-100, a procedure resembling that used to produce nuclear matrices. Tenacious attachment of SAR/MARs to the matrix through the later stages of the comet assay (alkaline treatment and electrophoresis) might explain the inability of the DHFR gene to leave the comet head even when the DNA is released from its supercoiling. In the case of the MGMT gene, the Texas red label was almost always in the comet head, but the fluorescein label did appear in the tail, consistent with the presence of a SAR/MAR near the 5'-end of the gene, though we have no independent evidence that this is the case. (The MGMT gene is sufficiently long that the 3'-end would be effectively free of a restraint imposed on the 5'-end.) On the basis of the appearance of both labels of the p53 gene and of the DHFR gene in the tail of human lymphocytes, since both genes are short, it seems that in these cells they are not associated with SAR/MARs. Figure 5 incorporates SAR/MARs in the model.
|
The significance of SAR/MARs in vivo is disputed. They may simply be regions that associate with DNA-binding proteins such as topoisomerases and enzyme complexes involved in replication or transcription, becoming incorporated into the matrix (a structure not demonstrated to exist in vivo) during isolation (Hancock, 2000
). A more physiological extraction method developed by Jackson et al. (1993) showed the retention of transcribing and replicating DNA at foci in a residual nuclear structure. DNA and RNA polymerases are immobilized in so-called replication and transcription factories, through which the DNA passes (Jackson et al., 1993; Cook, 1999). The association of the DHFR and MGMT genes in CHO cells with the comet head may thus reflect involvement of the DNA in transcription. In the model of Cook (1999), the DNA is attached to the factory upstream of the promoter of an active gene, consistent with the localization of the Texas red signal, indicating the 5'-end of the MGMT gene, in the head of the comet. A further possibility is that the damaged DNA is brought to the matrix for repair, so that the rapid relocalization of the p53 gene to the comet head may indicate that repair is in progress rather than completed.
Gene copy number and size
Although two alleles per cell were identified by the oligonucleotide probes for p53, as expected for lymphocytes in G1, there was a tendency for higher numbers of spots to be seen with the DHFR probes (Table I), perhaps indicating the presence of DHFR pseudogenes (Anagnou et al., 1988). CHO cells are aneuploid, and also proliferating, so the number of gene copies per cell is unpredictable. Sometimes we found fewer Texas red than fluorescein-labelled spots; either the efficiency of hybridization varied for the different oligonucleotide probes or the antibody cascade did not always reach sufficient intensity of fluorescence for detection.
A point to emphasize is the low level of damage that we are able to investigate. A comet with 50% of DNA in the tail corresponds to a strand break frequency of 1.6 per 109 Da or 0.5 per 103 kb, according to a calibration carried out with X-rays (Collins et al., 1996). Statistically, very few comets analysed will have breaks within the DHFR or p53 gene, but the gene will appear in the tail if the DNA loop within which it lies is relaxed by a strand break. Even in the case of the larger MGMT gene, breaks within the gene itself are infrequent at the levels of damage we study. The different rates of repair that we observe apply not to the individual genes, but to the DNA loops, or units of supercoiling, containing the genes.
Differential rates of DNA repair
Conventional studies of gene-specific repair have been directed at the level of restriction fragments of the gene of interest and with such a small target, high levels of damage must be inflicted to ensure that almost all restriction fragments contain a lesion. Typically, a dose of 10 J/m2 is administered (Mellon et al., 1986). A mechanism for preferential repair of transcribing DNA has been proposed (Hanawalt, 2001); the transcription complex stalls at sites of UV damage and this leads to recruitment of proteins to the complex which carry out repair and allow transcription to resume. Recent work with oxidative damage (LePage et al., 2000) has shown transcribed strand-specific removal of oxidized bases in human cells. Thymine glycol was induced by treatment of cells with10 mM H2O2 and 8-oxoguanine was presented to cells by transfection with a shuttle vector. The vector was constructed in alternative forms, with or without promoters, to control whether it was transcribed or not in the host cells. Cockayne syndrome cells lacking TCR were unable to remove 8-oxoguanine from the shuttle vector when it was transcribed, although they repaired it proficiently in the absence of transcription. Thus it seems that TCR is a process that releases the stalled RNA polymerase II from the lesion site and allows repair to proceed, a subtly different explanation from that developed from the experiments with UV.
The use of high (generally supra-lethal) doses of damage to investigate gene-specific repair rates raises the question of whether the findings of TCR apply under normal circumstances or whether they represent a response to extreme conditions. Use of the comet assay here imposes the opposite limitation; it is so sensitive that we cannot work above rather low doses of damaging agent, 1 J/m2 UV or 200 µM H2O2. Since the formation of a comet depends on relaxation of DNA loops, the information we obtain on differential rates of repair relates to the domain containing the labelled gene, i.e. the DNA loop, rather than the specific gene. The MGMT gene (equivalent to about half a loop in length) is in a section of DNA that shows relatively rapid repair of oxidized bases. Strand breaks induced by H2O2 in or near the p53 gene are repaired very quickly compared with total DNA, in agreement with McKenna et al. (2003), also using FISH with the comet assay, who reported that the p53 domain was preferentially repaired after 
-irradiation.
Conclusions
Repair rates of genes located in different segments of the genome are likely to differ, whether because they are being transcribed or for other reasons connected with sequence or location. We describe a novel approach to the analysis of repair rates of specific genes after low doses of damage. We find that CHO cells show preferential repair of oxidized bases in the MGMT gene, although only after a delay. Strand breaks in the human p53 gene are repaired very quickly compared with total DNA. This approach can be applied to other genes treated with a range of damaging agents. An intriguing possibility is that, using very long genes such as DMD, the dystrophin gene (2400 kb or 1 mm in length, with 79 exons), it will be possible to compare rates of repair of damage in different regions of the gene by the use of probes for selected pairs of exons.
In addition to providing information about differential repair rates, the comet assay with FISH can help with the analysis of gene organization and repair in relation to the structure of the nucleus. At the beginning of this discussion we reasoned that the appearance of signals in the comet head indicates that the gene is in an undamaged region of DNA. This supposition requires qualification. Certain genes (or parts of genes) remain in the head even when there is a DNA break nearby and it is likely that this affinity with the head reflects either the presence of a SAR/MAR in (or near) the gene or involvement of the gene in transcription.
|
Acknowledgements |
|---|
We thank Lawrence Chasin, Geoff Margison and Miroslav Pir
el for helpful comments and discussions and Leif Hunter and Pat Bain for excellent technical assistance. Experimental work carried out at the Rowett Research Institute was funded by the Scottish Executive Environment and Rural Affairs Department. E.Horváthová was supported by a fellowship from the International Agency for Research on Cancer. Sergey Shaposhnikov was the recipient of a FEBS Short Term Fellowship.
|
Notes |
|---|
5To whom correspondence should be addressed at: Department of Nutrition, University of Oslo, PO Box 1046, Blindern, 0316 Oslo, Norway. Tel: +47 22 85 13 60; Fax: +47 22 85 13 41; Email: a.r.collins{at}basalmed.uio.no
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
-
Anagnou,N.P., Antonarakis,S.E., O’Brien,S.J., Modi,W.S. and Nienhuis,A.W. (1988) Chromosomal localization and racial distribution of the polymorphic human dihydrofolate reductase pseudogene (DHFRP1). Am. J. Hum. Genet., 42, 345–352.[Web of Science][Medline]
Bohr,V.A., Smith,C.A., Okumoto,D.S. and Hanawalt,P.C. (1985) DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more efficient than in the genome overall. Cell, 40, 359–369.[CrossRef][Web of Science][Medline]
Collins,A.R. and Duinská,M. (2002) Oxidation of cellular DNA measured with the comet assay. In Armstrong,D. (ed.), Methods in Molecular Biology, Vol. 186: Oxidative Stress Biomarkers and Antioxidant Protocols. Humana Press, Totowa, NJ, pp. 147–159.
Collins,A.R. and Horváthová,E. (2001) Oxidative DNA damage, antioxidants and DNA repair: applications of the comet assay. Biochem. Soc. Trans., 29, 337–342.[CrossRef][Web of Science][Medline]
Collins,A.R., Ma,A. and Duthie,S.J. (1995) The kinetics of repair of oxidative DNA damage (strand breaks and oxidised pyrimidines) in human cells. Mutat. Res., 336, 69–77.[CrossRef][Web of Science][Medline]
Collins,A.R., Duinská,M., Gedik,C.M. and 
t
tina,R. (1996) Oxidative damage to DNA: do we have a reliable biomarker? Environ. Health Perspect., 104 (Suppl. 3), 465–469.[CrossRef][Web of Science][Medline]
Collins,A.R., Dobson,V.L., Duinská,M., Kennedy,G. and ttina,R. (1997) The comet assay: what can it really tell us? Mutat. Res., 375, 183–193.[Web of Science][Medline]
Cook,P.R. (1999) The organization of replication and transcription. Science, 284, 1790–1795.
Cook,P.R., Brazell,I.A. and Jost,E. (1976) Characterization of nuclear structures containing superhelical DNA. J. Cell Sci., 22, 303–324.[Abstract]
Frankenberg-Schwager,M. (1989) Review of repair kinetics for DNA damage induced in eukaryotic cells in vitro by ionizing radiation. Radiother. Oncol., 14, 307–320.[CrossRef][Web of Science][Medline]
Hanawalt,P.C. (2001) Controlling the efficiency of excision repair. Mutat. Res., 485, 3–13.[Web of Science][Medline]
Hancock,R. (2000) A new look at the nuclear matrix. Chromosoma, 109, 219–225.[CrossRef][Web of Science][Medline]
Jackson,D.A., Hassan,A.B., Errington,R.J. and Cook,P.R. (1993) Visualization of focal sites of transcription within human nuclei. EMBO J., 12, 1059–1065.[Web of Science][Medline]
Kas,E. and Chasin,L.S. (1987) Anchorage of the Chinese hamster dihydrofolate reductase gene to the nuclear scaffold occurs in an intragenic region. J. Mol. Biol., 198, 677–692.[CrossRef][Web of Science][Medline]
LePage,F., Kwoh,E.E., Avrutskaya,A., Gentil,A., Leadon,S.A., Sarasin,A. and Cooper,P.K. (2000) Transcription-coupled repair of 8-oxoguanine: requirement for XPG, TFIIH and CSB and implications for Cockayne syndrome. Cell, 101, 159–171.[CrossRef][Web of Science][Medline]
Madhani,H.D., Bohr,V.A. and Hanawalt,P.C. (1986) Differential DNA repair in transcriptionally active and inactive proto-oncogenes: c-abl and c-mos. Cell, 45, 417–423.[CrossRef][Web of Science][Medline]
McKelvey-Martin,V.J., Ho,E.T.S., McKeown,S.R., McCarthy,P.J., Rajab,N.F. and Downes,C.S. (1998) Emerging applications of the single cell gel electrophoresis (comet) assay. I. Management of invasive transitional cell human bladder carcinoma. II. Fluorescent in situ hybridization comets for the identification of damaged and repaired DNA sequences in individual cells. Mutagenesis, 13, 1–8.
McKenna,D.J., Rajab,N.F., McKeown,S.R., McKerr,G. and McKelvey-Martin,V.J. (2003) Use of the comet-FISH assay to demonstrate repair of the TP53 gene region in two human bladder carcinoma cell lines. Radiat. Res., 159, 49–56.[CrossRef][Web of Science][Medline]
Mellon,I., Bohr,V.A., Smith,C.A. and Hanawalt,P.C. (1986) Preferential DNA repair of an active gene in human cells. Proc. Natl Acad. Sci. USA, 83, 8878–8882.
Mellon,I., Spivak,G. and Hanawalt,P.C. (1987) Selective removal of transcription-blocking DNA damage from the transcribed strand of the mammalian DHFR gene. Cell, 51, 241–249.[CrossRef][Web of Science][Medline]
Pflaum,M., Will,O., Mahler,H.-C. and Epe,B. (1998) DNA oxidation products determined with repair endonucleases in mammalian cells: types, basal levels and influence of cell proliferation. Free Radic. Res., 29, 585–594.[CrossRef][Web of Science][Medline]
Rapp,A., Bock,C., Dittmar,H. and Greulich,K.-O. (2000) UV-A breakage sensitivity of human chromosomes as measured by COMET-FISH depends on gene density and not on the chromosome size. J. Photochem. Photobiol. B Biol., 56, 109–117.[CrossRef][Medline]
Santos,S.J., Singh,N.P. and Natarajan,A.T. (1997) Fluorescence in situ hybridization with comets. Exp. Cell Res., 232, 407–411. [CrossRef][Web of Science][Medline]
Taffe,B.G., Larminat,F., Laval,J., Croteau,D.L., Anson,R.M. and Bohr,V.A. (1996) Gene-specific nuclear and mitochondrial repair of formamidopyrimidine DNA glycosylase-sensitive sites in Chinese hamster ovary cells. Mutat. Res., 364, 183–192.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Shaposhnikov, E. Frengen, and A. R. Collins Increasing the resolution of the comet assay using fluorescent in situ hybridization--a review Mutagenesis, September 1, 2009; 24(5): 383 - 389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Schlormann and M. Glei Comet Fluorescence In Situ Hybridization (Comet-FISH): Detection of DNA Damage CSH Protocols, May 1, 2009; 2009(5): pdb.prot5220 - pdb.prot5220. [Abstract] [Full Text]
|
|
|
|
|
|
A. N. Jha Ecotoxicological applications and significance of the comet assay Mutagenesis, May 1, 2008; 23(3): 207 - 221. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Escobar, M. T. Smith, A. Vasishta, A. E. Hubbard, and L. Zhang Leukaemia-specific chromosome damage detected by comet with fluorescence in situ hybridization (comet-FISH) Mutagenesis, September 1, 2007; 22(5): 321 - 327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Shaposhnikov, C. Larsson, S. Henriksson, A. Collins, and M. Nilsson Detection of Alu sequences and mtDNA in comets using padlock probes. Mutagenesis, July 1, 2006; 21(4): 243 - 247. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||