Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burim, R. V.
Right arrow Articles by Takahashi, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burim, R. V.
Right arrow Articles by Takahashi, C. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Mutagenesis vol. 19 no. 4 pp. 291-298, July 2004
© 2004 UK Environmental Mutagen Society/Oxford University Press

Polymorphisms in glutathione S-transferases GSTM1, GSTT1 and GSTP1 and cytochromes P450 CYP2E1 and CYP1A1 and susceptibility to cirrhosis or pancreatitis in alcoholics

Regislaine Valéria Burim1, Renata Canalle1, Ana de Lôurdes Candolo Martinelli2 and Catarina Satie Takahashi1,3

1Department of Genetics and 2Department of Internal Medicine, Faculty of Medicine of Ribeirão Preto, São Paulo University, Av. Bandeirantes 3900, 14049-900 Ribeirão Preto, São Paulo, Brazil and 3Department of Biology, Faculty of Philosophy, Sciences and Letters of Ribeirão Preto, São Paulo University, Ribeirão Preto, São Paulo, Brazil


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Excessive alcohol consumption may cause the development of pathologies in the liver and pancreas and various digestive tract cancers. The enzymes GSTM1, GSTT1, GSTP1, CYP1A1 and CYP2E1 are involved in the bioactivation and detoxification of a variety of xenobiotics present in food, organic solvents, tobacco smoke, drugs, pesticides, environmental pollutants and alcoholic drinks. Polymorphisms in the genes coding for these enzymes have been associated with susceptibility to different diseases, including ethanol-related diseases. To investigate whether these polymorphisms represent risk-modifying factors for ethanol-related diseases, a study was conducted involving 120 Brazilian alcoholics and 221 controls with similar ethnic backgrounds. The distribution of alcoholics groups was as follows: 65 with liver cirrhosis, 14 with chronic pancreatitis and 41 without cirrhosis or pancreatitis. The data revealed that carriers of the rare GSTP1 Val allele were at higher risk of liver cirrhosis and pancreatitis, since we found higher frequencies of the Val/Val genotype in alcoholics with liver cirrhosis (15.4%) and pancreatitis (28.6%) in comparison with alcoholics without disease (7.3%). No differences were found in the prevalences of the GSTM1 and GSTT1 null genotypes between alcoholics and the controls and no association was found between the rare CYP2E1 c2 allele and liver cirrhosis and pancreatitis. However, when the mutant CYP1A1 allele was compared between alcoholics and controls, the m2/m2 genotype was more prevalent in the liver cirrhosis alcoholics (7.7%) than in the controls (1.4%) and this difference was statistically significant (P = 0.03, OR = 5.33). In conclusion, our data indicate an association between occurrence of the Val/Val GSTP1 genotype and chronic pancreatitis and an association between the m2/m2 CYP1A1 genotype and alcoholic liver cirrhosis. This could indicate that persons with these genotypes are genetically more prone to the development of alcoholic pancreatitis and alcoholic cirrhosis, respectively.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Excessive alcohol consumption causes physical, psychological and social problems. Alcohol abuse and dependence are major factors of morbidity and mortality in various countries (Greenfield et al., 2000Go). Moreover, alcohol abuse may cause the development of pathologies in the liver and pancreas and various digestive tract cancers (Longnecker, 1995Go). However, the vulnerability to ethanol hepatotoxicity varies significantly; 20% of chronic alcoholics develop liver cirrhosis, whereas 20% survive the chronic toxic effects without developing any pathology of the liver (Lelbach, 1975Go; Sorensen et al., 1984Go; Savolainen et al., 1993, 1995Go). Lack of a dose–response effect of alcohol on the liver may include multiple explanations concerning environmental and nutritional factors and infectious agents acting separately or in combination (Day and Bassendine, 1992Go). Twin studies have, however, convincingly shown that individual susceptibility to liver cirrhosis is at least partly genetically determined (Hrubec and Omenn, 1981Go).

Ethanol, similarly to most environmental toxins, requires metabolic activation and subsequent detoxification by a series of enzymes. Glutathione S-transferases (GSTs) are phase II xenobiotic metabolizing enzymes that catalyze the conjugation of electrophilic compounds with reduced glutathione to produce less toxic or readily excretable metabolites (Boyer, 1989Go). In more than 90% of cases the substrates for this reaction are provided by phase I xenobiotic metabolizing cytochrome P450 isozymes (CYPs). Although many chemicals are detoxified via this route, some compounds, including carcinogenic chemicals, undergo metabolic activation to give rise to ultimate carcinogens (Lewis et al., 1998Go). Therefore, the levels and duration of bioactivated toxic or carcinogenic compounds in an organ depend on the interplay of both biotransforming enzyme systems. Clearly, the yield of these metabolites would be higher, if cells were rich in phase I bioactivating enzymes but poor in detoxifying phase II enzymes (Standop et al., 2002Go).

Phase I and phase II biotransformation enzymes are characterized by zone-specific expression in the liver (Oinonen and Lindros, 1995Go) and the pancreas (Standop et al., 2002Go). Indeed, it is well known that long-term ethanol exposure induces various xenobiotic metabolizing enzymes, including CYPs (Bühler et al., 1991Go; Takahashi et al., 1993Go) and GSTs (Vanhaecke et al., 2000Go). Because both GSTs and CYPs are expressed zone-specifically and are induced by exposure to ethanol, an imbalance between these enzymes in determined areas of the liver or the pancreas might have a toxic effect (Standop et al., 2002Go). Thus, because GSTs play an important role in protecting the cell against cytotoxic and carcinogenic agents (Hayes and Pulford, 1995Go), the toxic load caused by CYP-mediated products might lead to a more rapid depletion of GSTs in areas with lower concentrations of these enzymes and, consequently, to a pronounced toxic effect, which might cause diseases such as cirrhrosis and chronic pancreatitis (Standop et al., 2002Go).

Individual variations in the metabolic activation and detoxification of chemical carcinogens and genotoxins, such as ethanol, are likely to be one of the major determinants of inter-individual differences in susceptibility to environmentally induced cancers. The genetic constitution seems to play the most important role in this context. An increasing number of xenobiotic metabolizing enzymes, such as GSTs and CYPs, have been shown to be polymorphic (Hirvonen, 1995Go).

Homozygous gene deletion has been associated with deficiencies in GSTM1 and GSTT1 enzyme activity and thus potential increases in the levels of toxic metabolites resulting from chronic ethanol administration (Seidegard et al., 1986Go). Therefore, because of its patho-biological association with alcohol-induced liver damage, genetic polymorphism of the GST1 locus may be important in the inherited susceptibility to liver cirrhosis (Savolainen et al., 1996Go). Several studies have, indeed, suggested that the GSTM1 and GSTT1 ‘null’ genotypes are risk factors for tumors such as bladder, breast, oral, lung, head and neck cancers (Schnakenberg et al., 2000Go; Mitrunen et al., 2001Go; Buch et al., 2002Go; Matthias et al., 2002Go; Hung et al., 2003Go). Polymorphisms of the GSTP1 gene were first reported by Board et al. (1989Go). They consisted of an A->G transition of nucleotide 313 in exon 5 (GSTP1*B) and a G->T transition of nucleotide 341 in exon 6 (GSTP1*C), involving the substitution of two amino acids in the enzyme active site, Ile->Val and Val->Ala. These allele variants appear to reduce GSTP1 activity, which could lead to genetic damage and increased cancer risk (Harries et al., 1997Go; Ryberg et al., 1997Go).

The human cytochromes P4502E1 (CYP2E1) and P4501A1 (CYP1A1) are among the most active cytochrome P450 isozymes that catalyze the bioactivation of many promutagens and procarcinogens (Guengerich and Shimada, 1991Go). Potentially important genetic polymorphisms have been described for CYP2E1 (Hayashi et al.,1991aGo; Uematsu et al., 1991Go) and CYP1A1 (Kawajiri et al., 1990Go; Hayashi et al., 1991bGo) and have been suggested as genetic markers for cancer risk. The CYP2E1*2 allele was attributed to the first polymorphism discovered in 1987 by McBride et al. (1987Go), which consists of a C->G mutation in intron 7 that creates a restriction site for the enzyme TaqI. Two polymorphisms are recognized by the RsaI restriction enzyme, called CYP2E1*3 and CYP2E1*5. Unlike *5, *3 results from loss of a restriction site for RsaI and is in complete linkage disequilibrium with another restriction site recognized by PstI. These gene mutations appear to act at the level of transcription of the enzyme, increasing its activity (Pavanello and Clonfero, 2000Go). Two genetically linked polymorphisms of CYP1A1, MspI site (T3801->C, CYP1A1*2 allele) and Ile462->Val (CYP1A1*3 allele), are the most studied and confer at least 3-fold increases in its catalytic activity (Garte, 1998Go).

These polymorphisms have formerly been shown to be associated with lung cancer for CYP1A1 (Kawajiri et al., 1990Go) and cirrhosis for CYP2E1 (Tsutsumi et al., 1994Go), indicating the importance of the investigation of inherited susceptibility to diseases caused by exposure to xenobiotics such as ethanol.

The present study was carried out to investigate and compare frequencies of the GSTM1 and GSTT1 ‘null’ polymorphisms and the mutant alleles of GSTP1, CYP2E1 and CYP1A1 in both alcoholic and non-alcoholic populations and to study the association of the polymorphisms with susceptibility to liver cirrhosis and alcoholic pancreatitis.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Subjects
A study was conducted involving 120 Brazilian alcoholics and 221 controls with similar ethnic backgrounds. The distribution of alcoholics was as follows: 65 with liver cirrhosis, 14 with chronic pancreatitis and 41 without cirrhosis or pancreatitis. The diagnoses of cirrhosis and pancreatitis were based on signs of inequivocal liver and pancreas damage, respectively, assessed by clinical, biochemical and echographic findings.

All alcoholics were classified as heavy consumers (daily intake >40 g ethanol), according to the information obtained from hospital records. The patients were tested for present or previous viral hepatitis infections and subjects positive for presence of the B or C virus type were excluded from the sample. The patients were diagnosed between June 1991 and June 2002 at the Department of Clinical Medicine of the University Hospital of the Faculty of Medicine of Ribeirão Preto, University of São Paulo and the Santa Tereza Hospital of Ribeirão Preto. The recruited patients comprised 103 males and 17 females between the ages of 22 and 76 years (mean age 48.28 years). A general population control group (n = 221) was composed of 159 males and 62 females, non-alcoholics, between the ages of 18 and 58 years (mean age 31.5 years). These subjects were recruited from blood donors attending the Hematology Center at the same University Hospital to provide a representative group of the general population that seeks medical assistance in the region, located in São Paulo State, south-eastern Brazil. The Ethical Committee (Proc. no. 6052/98) of the participating institutions approved the human subject protocol and written informed consent was obtained from all subjects. Based on phenotype characteristics, 93 patients and 180 controls were white, 10 and 22 were black and 17 and 19 were mulatto, respectively.

Genotype analysis
DNA isolation Genomic DNA samples were obtained from blood lymphocytes using a Wizard® Genomic DNA Purification Kit (Promega, Madison, WI). Isolated DNA was resuspended in Tris–EDTA buffer (pH 8.0) and stored at –20°C until use.

GSTM1 and GSTT1 polymorphisms The GSTM1 and GSTT1 genes were determined simultaneously in a single assay using the multiplex PCR approach described by Abdel-Rahman et al. (1996Go). The PCR products were then analyzed by electrophoresis on an ethidium bromide stained (10 mg/ml) 2% 3:1 Nusieve agarose gel (FMC BioProducts, Rockland, ME). The GSTM1 and GSTT1 genes were detected by the presence or absence of bands at 480 and 215 bp, respectively. A band at 312 bp (CYP1A1) demonstrated successful amplification.

GSTP1 polymorphisms The method previously described by Harries et al. (1997Go) was used for PCR–RFLP analysis of GSTP1 codon 105 genotype. This assay distinguishes between homozygosity for the Ile105 wild-type allele, heterozygosity (Ile105/Val105) and homozygosity for the Val105 mutant allele. Briefly, a DNA fragment of 176 bp was amplified using the primers P105 F (5'-ACCCCAGGGCTCTATGGGAA) and P105 R (5'-TGAGGGCACAAGAAGCCCCT). After amplification, the PCR products (20 µl) were digested with 5 U BsmaI restriction endonuclease (New England Biolabs, Beverely, MA) in a total volume of 25 µl and the products were separated by electrophoresis on an ethidium bromide stained 3.5% Metaphor agarose gel (FMC BioProducts). Mutation resulted in smaller fragments (91 and 85 bp compared with 176 bp).

CYP2E1 polymorphisms PCR–RFLP was performed to investigate the CYP2E1 gene using the primers and conditions previously described by Anwar et al. (1996Go). A PCR procedure was used to amplify the transcription regulation region of CYP2E1, which includes a PstI restriction site (Hayashi et al., 1991aGo). Briefly, 20 µl of the PCR product was then digested with 6 U PstI restriction enzyme (Gibco-Invitrogen, Carlsbad, CA) and the fragments separated by electrophoresis on an ethidium bromide stained 2.0% agarose gel. The presence of a PstI restriction site, indicative of a mutant allele (c2), is shown by two fragments of 290 and 120 bp.

CYP1A1 polymorphisms The CYP1A1 genotypes ascribed to the mutation at position 6235 in the 3'-flanking region, causing a new cut site for the restriction enzyme MspI, were identified using a modification of a PCR–RFLP approach described previously by Carstensen et al. (1993Go). A DNA fragment of 340 bp (homozygous for the wild-type allele, m1) was amplified in 25 µl containing 100 ng genomic DNA, 100 ng each of primers C44 (5' TAGGAGTCTTGTCTCATGCCT) and C47 (5' CAGTGAAGAGGTGTAGCCGCT), 2 mM dNTPs, 2.5 µl PCR buffer (20 mM Tris–HCl, 50 mM KCl, pH 8.4), 2 mM MgCl2 and 1.25 U Taq DNA polymerase (Gibco-Invitrogen). Initial denaturation was carried out at 94°C for 5 min, followed by 30 cycles at 94°C for 1 min, 57°C for 1 min and 72°C for 1 min 30 s. A final extension step of 72°C for 2 min terminated the process. After amplification, the PCR products (20 µl) were digested with 5 U MspI restriction enzyme (New England Biolabs) in a total of 25 µl and the fragments separated by electrophoresis on an ethidium bromide stained 2.0% agarose gel (Gibco-Invitrogen), resulting in fragments of 200 and 140 bp in the case of the mutation (homozygous for the mutant allele, m2).

All the experiments included positive and negative controls for each studied polymorphism.

Statistical analysis
The statistical significance of the differences between groups was calculated using the Fisher exact test (two-tailed) (Agresti, 1992Go). Crude odds ratios (OR) were calculated and are given with 95% confidence intervals (CI) (Kleinbaum, 1982Go). The probability level of significance was fixed at P < 0.05. Age, race and gender were included as co-variables, as were all genotypes studied and possible interactions. Individuals having the null genotype for GSTM1 and GSTT1 who were homozygous for the GSTP1, CYP1A1 and CYP2E1 variants and/or carriers of at least one GSTP1, CYP1A1 or CYP2E1 mutant allele were considered at risk.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The distributions of the GSTM1, GSTT1, GSTP1 (BsmaI polymorphism), CYP1A1 (MspI polymorphism) and CYP2E1 (PstI polymorphism) genotypes in chronic alcoholics (n = 120) compared with controls (n = 221) of similar ethnic background are reported in Table I. In the controls, the frequencies of the polymorphism tested were in agreement with those reported for other populations of European and African descent (Stephens et al., 1994Go; Hamada et al., 1995Go; Harries et al., 1997Go; Arruda et al., 1998Go; Watson et al., 1998Go; Gattás and Soares-Vieira, 2000Go). Multivariate analysis, including age, race and gender as co-variables, did not modify our conclusions for any variant tested.


View this table:
[in this window]
[in a new window]
 
Table I.. Frequency distributions of the GSTM1, GSTT1, GSTP1, CYP2E1 and CYP1A1 genotypes in alcoholics and controls
 
GSTM1 and GSTT1 polymorphisms
Homozygous deletion of the GSTM1 and GSTT1 loci, the ‘null’ genotype, was found in 45.0 and 23.3% of the total alcoholics (with liver cirrhosis + with pancreatitis + without disease), and in 45.7 and 19.5% of the controls (data not shown). The differences in occurrence of the ‘null’ genotypes between total alcoholics and controls were not statistically significant (P = 0.91 and 0.40, respectively, for the GSTM1 and GSTT1 loci). The Hardy–Weinberg equilibrium could not be tested because of the inability of the present PCR protocol to separate heterozygous carriers of the deletion polymorphisms.

GSTM1 and GSTT1 ‘null’ polymorphisms
The Tables I and II show the results for the GSTM1 and GSTT1 genotypes in the liver cirrhosis alcoholics, chronic alcoholics with pancreatitis, chronic alcoholics without clinical evidence of alcoholism-related disease and non-alcoholic controls. A comparison of the occurrence of the GSTM1 and GSTT1 ‘null’ genotypes among control non-alcoholics and alcoholics with liver cirrhosis, with pancreatitis or without disease was not statistically significant. A comparison of the occurrence of the GSTM1 and GSTT1 ‘null’ genotypes among alcoholics without disease and alcoholics with liver cirrhosis or pancreatitis produced similar results.


View this table:
[in this window]
[in a new window]
 
Table II.. Distribution of the GSTM1, GSTT1, GSTP1, CYP2E1 and CYP1A1 genotypes in alcoholics in comparison with the controls
 
We also observed that, even though it was not statistically significant, the frequency of the GSTT1 ‘null’ genotype in alcoholics with pancreatitis (35.7%) was higher that than of the controls (19.5%) and alcoholics without disease (22.0%) (Tables IIII).


View this table:
[in this window]
[in a new window]
 
Table III.. Distribution of the GSTM1, GSTT1, GSTP1, CYP2E1 and CYP1A1 genotypes in alcoholics with cirrhosis and pancreatitis in comparison with alcoholics without diseases
 
GSTP1 polymorphisms
The distribution of the BsmaI polymorphism in the GSTP1 gene was compared in 221 non-alcoholic controls and 79 alcoholics with ethanol-related diseases (liver cirrhosis or pancreatitis) or without clinical symptoms (n = 41). There was no observed statistically significant difference between the controls and alcoholics or between alcoholics without disease and those with liver cirrhosis or pancreatitis for the Ile/Val genotype. However, a comparison of the occurrence of the Val/Val genotype among alcoholics with pancreatitis and the non-alcoholic controls was statistically nearly significant (P = 0.09, OR = 3.17, 95% CI = 0.84–11.97), with the Val/Val genotype being more frequent among alcoholics with pancreatitis (28.6%) than in the controls (8.1%) (Table II).

We also observed a possible association between the Val/Val genotype and an increased susceptibility to development of liver cirrhosis and pancreatitis in chronic alcoholics, since we found higher frequencies of the Val/Val genotype in alcoholics with liver cirrhosis (15.4%) and pancreatitis (28.6%) in comparison with alcoholics without disease (7.3%). However, the differences in the frequencies of this genotype between alcoholics with and without ethanol-related diseases were not statistically significant (Table III).

Allele frequencies for the GSTP1 gene are reported in Table IV. There was no statistically significant difference in the frequencies of the rare Val allele shown between the different groups. All of the distributions were in Hardy–Weinberg equilibrium.


View this table:
[in this window]
[in a new window]
 
Table IV.. Allele frequencies in alcoholics and controls
 
CYP2E1 polymorphisms
Tables IIII show the results for the CYP2E1 genotypes. The frequencies found for the c1/c2 genotype were 9.2% in liver cirrhosis alcoholics, 21.4% in alcoholics with pancreatitis, 9.8% in alcoholics without disease and 10.4% in the controls. These data show an increased frequency of the c1/c2 genotype in alcoholics with pancreatitis when compared with the control and alcoholics without disease groups, but this increase was not statistically significant. There were no significant differences in the frequencies of the c1/c2 genotype when the other groups were compared. No alcoholics were found to be homozygous for the rare c2 allele.

The frequency of the c2 allele was higher in alcoholics with pancreatitis in comparison with the other groups, but this difference was not significant. All of the distributions were in Hardy–Weinberg equilibrium.

CYP1A1 polymorphisms
In the case of the MspI polymorphism of the CYP1A1 gene, the frequencies of the m1/m2 genotype were similar among all groups studied. However, differences in the frequencies of the m2/m2 genotype were found between groups. We observed higher frequencies of the m2/m2 genotype in alcoholics when compared with the controls. The m2/m2 genotype was more prevalent in alcoholics with liver cirrhosis (7.7%) than in the controls (1.4%), this difference being statistically significant (P = 0.03, OR = 5.33, 95% CI = 1.23–23.14). We found an association between the m2/m2 genotype and an increased susceptibility to development of cirrhosis and pancreatitis in chronic alcoholics, since the frequencies of the mutant genotype for the CYP1A1 gene were higher in alcoholics with disease than those in alcoholics without disease. However, the differences in the frequencies of this genotype between alcoholics with and without ethanol-related disease were not statistically significant (Tables IIII).

No association was observed between controls and alcoholics and between alcoholics with and without ethanol-related disease when the frequencies of the rare m2 allele of CYP1A1 were compared (Table IV). All of the distributions were in Hardy–Weinberg equilibrium.

To further elucidate the genetic factors associated with susceptibility to development of ethanol-related diseases, the role of combined genetic polymorphisms in the GSTM1, GSTT1, GSTP1, CYP2E1 and CYP1A1 genes was investigated. The reference groups (OR = 1.0) were defined as subjects having the following ‘low risk’ genotypes: presence of GSTM1 and GSTT1, GSTP1 Ile/Ile, CYP1A1 m1/m1 and CYP2E1 c1/c1. The genotypes considered ‘high risk’ were: absence of GSTM1 and GSTT1, GSTP1 Ile/Val or Val/Val, CYP1A1 m1/m2 or m2/m2 and CYP2E1 c1/c2 or c2/c2. Next, the frequency distributions of combined genotypes of the five polymorphisms were assessed and similar genotype distributions were seen for all alcoholic groups and the non-alcoholic controls (data not shown). In order to examine the effect of tobacco and alcohol consumption on disease susceptibility, the genetic analysis was also carried out for two groups: smoker alcoholics and non-smoker alcoholics. However, again there was no significant difference between the two groups (results not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Only 10–40% of chronic alcoholics develop liver cirrhosis or chronic pancreatitis in response to heavy consumption lasting over years or decades (Lelbach, 1975Go; Sorensen et al., 1984Go; Savolainen et al., 1993, 1995Go).

The oxidative metabolism of xenobiotics, such as ethanol, is performed mainly by cytochrome P450 enzymes, which are expressed as a genetically related enzyme family primarily in hepatocytes. The pancreas is among the extra-hepatic tissues expressing CYP and it has been suggested that intermediates generated by them might be of pathogenetic significance for diseases of the pancreas such as pancreatitis (Wacke et al., 1998Go).

In the case of cirrhosis, one essential contributor to the severity of this disease is the induction of cytochrome CYP2E1 by chronic alcohol consumption and concomitantly increased formation of acetaldehyde and reactive oxygen species, as well as ethanol-derived free radicals (Terelius et al., 1978Go). Subsequently, the liver is exposed to increased acetaldehyde toxicity, as well as increased oxidative stress, thus compromising vital cellular functions, stimulating lipid peroxidation of cellular membranes and increasing alcoholic liver fibrogenesis (Lindros, 1995Go). In cirrhosis, GSTs catalyze the conjugation of highly toxic acetaldehyde and oxygen radicals to reduced glutathione (GSH) created by the induced CYP2E1. An intracellular pool of GSH functions as a buffer in the detoxification of a variety of toxic electrophiles and the quantity of GSH may well be a limiting factor in conjugation reactions during severe toxic stress (Lieber, 1994Go). Thus, a compromised GSH status renders hepatocytes defenseless against toxic ethanol metabolites and precedes a deterioration in mitochondrial function and structural changes (Fernandez-Checa et al., 1993Go). Inadequate function of GSTs in the detoxification processes could therefore alter the course of cirrhosis, making it a suitable candidate gene in the hunt for genetic markers indicating inherited susceptibility to cirrhosis.

Here we determined the frequencies of the GSTM1, GSTT1, GSTP1, CYP1A1 and CYP2E1 genotypes in Brazilian alcoholics with liver cirrhosis and chronic pancreatitis and in a control group, all of similar ethnic background. The overall frequencies of the tested genotypes in control subjects agreed with those reported in other studies (Kleinbaum, 1982Go; Stephens et al., 1994Go; Hamada et al., 1995Go; Arruda et al., 1998Go; Watson et al., 1998Go; Gattás and Soares-Vieira, 2000Go). We found no increased risk for cirrhosis or chronic pancreatitis associated with the GSTM1 ‘null’ genotype. Thus, our results do not support the concept that the GSTM1 gene has a role in susceptibility to liver cirrhosis and chronic alcoholic pancreatitis. Similar results were obtained by Frenzer et al. (2002Go) in adult Caucasian alcoholics with liver cirrhosis and chronic pancreatitis, by Rodrigo et al. (1999Go) for liver cirrhosis in alcoholics in northern Spain and by Groppi et al. (1991Go) in cirrhotic alcoholic Caucasians. In contrast, Baranov et al. (1996Go), Harada et al. (1993Go) and Savolainen et al. (1996Go) found an increased risk of liver cirrhosis associated with the GSTM1 ‘null’ genotype in chronic alcoholics.

There are no obvious reasons for the discrepancy between the results obtained in the different studies. A potential problem in assessing the frequencies of the GSTM1 ‘null’ genotype in a given disease is the marked variation in frequencies observed both among and within different ethnic groups (Lin et al., 1994Go; Nelson et al., 1995Go). The ethnic origin of the Brazilian population is highly heterogeneous, consisting of indigenous Amerindian populations and immigrants from Europe, Africa and Asia (Arruda et al., 1998Go; Alves-Silva et al., 2000Go; Carvalho-Silva, 2001Go). However, no differences in the frequencies of the GSTM1 ‘null’ genotype were found in our control group and those obtained by Arruda et al. (1998Go) in their Brazilian control groups. Thus, the divergence between our results and those previously reported (Harada et al., 1993Go; Baranov et al., 1996Go; Savolainen et al., 1996Go) cannot be attributed to the origin of the populations.

The frequencies of the GSTT1 genotype were similar among alcoholics with liver cirrhosis and alcoholics without ethanol-related disease and controls. Similar results were obtained by Frenzer et al. (2002Go). When compared with alcoholics without disease (22.0%) and with the controls (19.5%), the GSTT1 ‘null’ genotype occurred more frequently in alcoholics with chronic pancreatitis (37.7%) and these results could indicate a possible ‘risk genotype’. However, when submitted to statistical analysis, no significance was indicated. Frenzer et al. (2002Go) also observed no significance for the association GSTT1 ‘null’ genotype and increased risk of chronic pancreatitis in alcoholics.

There are almost no literature reports of genotype frequencies for GSTP1 gene polymorphisms in alcoholics with liver cirrhosis or chronic pancreatitis. To our knowledge, this study is the first report on the GSTP1 genotype and liver cirrhosis and chronic pancreatitis risk in alcoholics. In our study population we observed higher frequencies of the Val/Val genotype in patients with alcoholic liver disease (15.4%) and in patients with chronic pancreatitis (28.6%) when these data were compared with alcoholics without disease (7.3%) and the controls (8.1%). A comparison of the frequencies among these groups was significant in some cases and not in others. These differences could have occurred because of the low number of subjects, thus additional studies are needed that can reliably detect the relative risk. However, a trend is clear, of an increase in the Val/Val genotype in alcoholics with liver cirrhosis and chronic pancreatitis.

Our data support the hypothesis that the GSTP1 codon 105 polymorphism might play a role in susceptibility to development of cirrhosis and pancreatitis. This is consistent with prior observations showing that this polymorphism alters protein function. Biochemical studies have demonstrated a lower thermal stability of GSTP1 Val compared with GSTP1 Ile (Nelson et al., 1995Go; Alves-Silva et al., 2000Go) and also lower conjugating activity of Val homozygous compared with Ile homozygous, with heterozygous displaying intermediate activity (Watson et al., 1998Go). Individuals with at least one Val allele at codon 105 of GSTP1 may have an underlying predisposition to cancer when exposed to environmentally derived or endogenously formed GSTP1 substrates that are a risk factor (Harries et al., 1997Go). Indeed, the GSTP1 codon 105 Val allele has been reported to be associated with a significantly increased risk of bladder, testicular (Harries et al., 1997Go) and gastric (Setiawan et al., 2001Go) cancers.

Several studies based on Japanese populations have investigated the CYP2E1 polymorphism in alcoholic patients and some of them reported a strong association between the c2 allele and the development of disease (Tsutsumi et al., 1994Go). However, other studies described an increased frequency of the c1 allele among alcoholic cirrhotics (Maezawa et al., 1994Go). Other series, based on white populations, have not found an association between this disease and the c1 or c2 alleles (Couzigou et al., 1990Go; Carr et al., 1995Go; Rodrigo et al., 1999Go) and pancreatitis (Maruyama et al., 1999Go). In agreement with others, we have also failed to find a significant association of alcoholic cirrhosis or chronic alcoholic pancreatitis with either the c1 or c2 allele. However, owing to the very low frequency of the c2 allele in our population, to rule out a statistical association of this polymorphism with the development of the disease would require the genotyping of a much greater number of patients.

CYP1A1 is important for the activation of precarcinogens (Ingelman-Sundberg, 2001Go). The CYP1A1 locus is a candidate susceptibility gene for cancers of the upper aerodigestive tract according to studies in diseases associated with alcohol and tobacco consumption (Matthias et al., 1998Go). The MspI polymorphism located in the 3'-flanking region of the CYP1A1 gene was originally found to be associated with lung cancer in Asians (Kawajiri et al., 1990Go), but not in Caucasians (Tefre et al., 1991Go). No differences in the allele distribution were observed between controls and alcoholics or between alcoholic patients with or without cirrhosis in the study by Lucas et al. (1996Go). However, our data showed a difference in the frequency of the m2/m2 CYP1A1 genotype between the groups studied. When compared with the controls (1.4%), the m2/m2 CYP1A1 genotype occurred more frequently in patients with liver cirrhosis (7.7%, P = 0.03, OR = 5.33, 95% CI = 1.23–23.14) and pancreatitis (7.1%), thus indicating a possible ‘risk genotype’. We therefore suggest that this mutated genotype plays an important role in the development of these diseases.

The genetics of cirrhosis and pancreatitis are a complex issue; the pathophysiologies of alcoholic liver cirrhosis and pancreatitis are not completely established and, thus, selection of candidate genes may be incomplete or even erroneous. Furthermore, genetic susceptibility to these diseases may be blurred by differences in alcohol consumption patterns, as well as by the effect of other possible susceptibility to develop cirrhosis and pancreatitis, which may require careful examination of multiple genes (intragenic markers or polymorphic areas nearby) in large populations, which are difficult to obtain.

In conclusion, we found a nearly significant association between occurrence of the Val/Val GSTP1 genotype and chronic pancreatitis and we found a statistically significant association between occurrence of the m2/m2 CYP1A1 genotype and alcoholic liver cirrhosis. This could indicate that persons with these genotypes are genetically more prone to development of alcoholic pancreatitis and alcoholic cirrhosis, respectively. The latter data presented here for alcoholics with pancreatitis should be used with some caution, because it is based on only 14 patients, and additional data using more cases are needed to confirm this finding.

The results in this paper represent an initial step in our effort to understand the susceptibility to develop cirrhosis and pancreatitis in alcoholics and will be of importance in the prevention of these diseases and/or the development of better therapies.


    Acknowledgements
 
We are grateful to Mr L.A.Costa Jr and Miss S.A.Neves for valuable technical assistance. We also thank Prof. Dr Alexandre Souto Martinez (Departamento Física, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo) for the statistical analysis. This research was supported by FAPESP (Proc. no. 98/11878-5), CNPq and CAPES (Brazil).


    Notes
 
4To whom correspondence should be addressed. Tel: +55 16 602 3082; Fax: +55 16 633 0069; Email: cstakaha{at}usp.br


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

    Abdel-Rahman,S.Z., el-Zein,R.A., Anwar,W.A. and Au,W.W. (1996) A multiplex PCR procedure for polymorphic analysis of GSTM1 and GSTT1 genes in population studies. Cancer Lett., 107, 229–233.[CrossRef][Web of Science][Medline]

    Agresti,A. (1992) A survey of exact inference for contegency tables. Stat. Sci., 7, 131–153.[CrossRef]

    Alves-Silva,J., da Silva Santos,M., Guimarães,P.E., Ferreira,A.C., Bandelt,H.J., Pena,S.D. and Prado,V.F. (2000) The ancestry of Brazilian mtDNA lineages. Am. J. Hum. Genet., 67, 444–461.[CrossRef][Web of Science][Medline]

    Anwar,W.A., Abdel-Rahman,S.Z., El-Zein,R.A., Mostafa,H.M. and Au,W.W. (1996) Genetic polymorphism of GSTM1, CYP2E1 and CYP2D6 in Egyptian bladder cancer patients. Carcinogenesis, 17, 1923–1929.[Abstract/Free Full Text]

    Arruda,V.R., Grignolli,C.E., Goncalves,M.S., Soares,M.C., Menezes,R., Saad,S.T. and Costa,F.F. (1998) Prevalence of homozygosity for the deleted alleles of glutathione S-transferase mu (GSTM1) and theta (GSTT1) among distinct ethnic groups from Brazil: relevance to environmental carcinogenesis? Clin. Genet., 54, 210–214.[Web of Science][Medline]

    Baranov,V.S., Ivaschenko,T., Bakay,B. et al. (1996) Proportion of the GSTM1 0/0 genotype in some Slavic populations and its correlation with cystic fibrosis and some multifactorial diseases. Hum. Genet., 97, 516–520.[Web of Science][Medline]

    Board,P.G., Webb,G.C. and Coggan,M. (1989) Isolation of a cDNA clone and localization of the human glutathione S-transferase 3 genes to chromosome bands 11q13 and 12q13–14. Ann. Hum. Genet., 53, 205–213.[Web of Science][Medline]

    Boyer,T.D. (1989) The glutathione S-transferases: Na update. Hepatology, 9, 486–496.[Web of Science][Medline]

    Buch,S.C., Notani,P.N. and Bhisey,R.A. (2002) Polymorphism at GSTM1, GSTM3 and GSTT1 gene loci and susceptibility to oral cancer in an Indian population. Carcinogenesis, 23, 803–807.[Abstract/Free Full Text]

    Bühler,R., Lindros,K., von Bouslawsky,K., Karkktlinen,P., Makinen,J. and Ingelman-Sundberg,M. (1991) Perivenous expression of ethanol-inducible cytochrome P450 IIE1 in livers from alcoholics and chronically ethanol-fed rats. Alcohol Alcohol, 1 (Suppl.), 311–315.

    Carr,L.G., Hartleroad,J.Y., Liang,Y., Mendenhall,C., Moritz,T. and Thomasson,H. (1995) Polymorphism at the P450IIE1 locus is not associated with alcoholic liver disease in Caucasian men. Alcohol Clin. Exp. Res., 19, 182–184.[CrossRef][Web of Science][Medline]

    Carstensen,U., Alexandrie,A.K., Hogstedt,B., Rannug,A., Bratt,I. and Hagmar,L. (1993) B- and T-lymphocyte micronuclei in chimney sweeps with respect to genetic polymorphism for CYP1A1 and GST1 (class Mu). Mutat. Res., 289, 187–195.[CrossRef][Web of Science][Medline]

    Carvalho-Silva,D.R., Santos,F.R., Rocha,J. and Pena,S.D. (2001) The phylogeography of Brazilian Y-chromosome lineages. Am. J. Hum. Genet., 68, 281–286.[CrossRef][Web of Science][Medline]

    Couzigou,P., Fleury,B., Groppi,A., Cassaigne,A., Begueret,J. and Iron,A. (1990) Genotyping study of alcohol dehydrogenase class I polymorphism in French patients with alcoholic cirrhosis. The French Group for Research on Alcohol and Liver. Alcohol Alcohol, 25, 623–626.[Abstract/Free Full Text]

    Day,C.P. and Bassendine,M.F. (1992) Genetic predisposition to alcoholic liver disease. Gut, 33, 1444–1447.[Free Full Text]

    Fernandez-Checa,J.C., Hirano,T., Tsukamoto,H. and Kaplowitz,N. (1993) Mitochondrial glutathione depletion in alcoholic liver disease. Alcohol, 10, 469–475.[CrossRef][Web of Science][Medline]

    Frenzer,A., Butler,W.J., Norton,I.D., Wilson,J.S., Apte,M.V., Pirola,R.C., Ryan,P. and Roberts-Thomson,I.C. (2002) Polymorphism in alcohol-metabolizing enzymes, glutathione S-transferases and apolipoprotein E and susceptibility to alcohol-induced cirrhosis and chronic pancreatitis. J. Gastroenterol. Hepatol., 17, 177–182.[CrossRef][Web of Science][Medline]

    Garte,S. (1998) The role of ethnicity in cancer susceptibility gene polymorphisms: the example of CYP1A1. Carcinogenesis, 19, 1329–1332.[Abstract/Free Full Text]

    Gattás,G.J. and Soares-Vieira,J.A. (2000) Cytochrome P450-2E1 and glutathione S-transferase mu polymorphisms among Caucasians and mulattoes from Brazil. Occup. Med., 50, 508–511.[Abstract/Free Full Text]

    Greenfield,T.K., Midanik,L.T. and Rogers,J.D. (2000) A 10-year national trend study of alcohol consumption, 1984–1995: is the period of declining drinking over? Am. J. Public Health, 90, 47–52.[Abstract/Free Full Text]

    Groppi,A., Coutelle,C., Fleury,B., Iron,A., Begueret,J. and Couzigou,P. (1991) Glutathione S-transferase class mu in French alcoholic cirrhotic patients. Hum. Genet., 87, 628–630.[Web of Science][Medline]

    Guengerich,F.P. and Shimada,T. (1991) Oxidation of toxic and carcinogenic chemicals by human cytochrome P-450 enzymes. Chem. Res. Toxicol., 4, 391–407.[CrossRef][Web of Science][Medline]

    Hamada,G.S., Sugimura,H., Suzuki,I. et al. (1995) The heme-binding region polymorphism of cytochrome P450IA1 (CypIA1), rather than the RsaI polymorphism of IIE1 (CypIIE1), is associated with lung cancer in Rio de Janeiro. Cancer Epidemiol. Biomarkers Prev., 4, 63–67.[Abstract]

    Harada,S., Takase,S., Horiike,N., Ishii,K., Ishii,H. and Takada,A. (1993) Genetic and epidemiologic studies on alcoholic liver diseases. Arukoru Kenkyuto Yakubutsu Ison, 28, 400–13.[Medline]

    Harries,L.W., Stubbins,M.J., Forman,D., Howard,G.C. and Wolf,C.R. (1997) Identification of genetic polymorphisms at the glutathione S-transferase Pi locus and association with susceptibility to bladder, testicular and prostate cancer. Carcinogenesis, 18, 641–644.[Abstract/Free Full Text]

    Hayashi,S., Watanabe,J. and Kawajiri,K. (1991a) Genetic polymorphisms in the 5'-flanking region change transcriptional regulation of the human cytochrome P450IIE1 gene. J. Biochem. (Tokyo), 110, 559–565.[Abstract/Free Full Text]

    Hayashi,S., Watanabe,J., Nakachi,K. and Kawajiri,K. (1991b) Genetic linkage of lung cancer-associated MspI polymorphisms with amino acid replacement in the heme binding region of the human cytochrome P450IA1 gene. J. Biochem. (Tokyo), 110, 407–411.[Abstract/Free Full Text]

    Hayes,J.D. and Pulford,D.J. (1995) The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit. Rev. Biochem. Mol. Biol., 30, 445–600.[Web of Science][Medline]

    Hirvonen,A. (1995) Genetic factors in individual responses to environmental exposures. J. Occup. Environ. Med., 37, 37–43.[CrossRef][Web of Science][Medline]

    Hrubec,Z. and Omenn,G.S. (1981) Evidence of genetic predisposition to alcoholic cirrhosis and psychosis: twin concordances for alcoholism and its biological end points by zygosity among male veterans. Alcohol. Clin. Exp. Res., 5, 207–215.[Web of Science][Medline]

    Hung,R.J., Boffetta,P., Brockmoller,J. et al. (2003) CYP1A1 and GSTM1 genetic polymorphisms and lung cancer risk in Caucasian non-smokers: a pooled analysis. Carcinogenesis, 24, 875–882.[Abstract/Free Full Text]

    Ingelman-Sundberg,M. (2001) Genetic susceptibility to adverse effects of drugs and environmental toxicants. The role of the CYP family of enzymes. Mutat. Res., 482, 11–19.[Web of Science][Medline]

    Kawajiri,K., Nakachi,K., Imai,K., Yoshii,A., Shinoda,N. and Watanabe,J. (1990) Identification of genetically high risk individuals to lung cancer by DNA polymorphisms of the cytochrome P450IA1 gene. FEBS Lett., 263, 131–133.[CrossRef][Web of Science][Medline]

    Kleinbaum,D.G., Kupper,L.L. and Morgenstern,H. (1982) Epidemiologic Research: Principles and Quantitative Methods. Wadsworth, Belmont, CA.

    Lelbach,W.K. (1975) Cirrhosis in the alcoholic and its relation to the volume of alcohol abuse. Ann. N. Y. Acad. Sci., 252, 85–105.[Web of Science][Medline]

    Lewis,D.F., Ioannides,C. and Parke,D.V. (1998) Cytochromes P450 and species differences in xenobiotic metabolism and activation of carcinogen. Environ. Health Perspect., 106, 633–641.[Web of Science][Medline]

    Lieber,C.S. (1994) Alcohol and the liver: 1994 update. Gastroenterology, 106, 1085–105.[Web of Science][Medline]

    Lin,H.J., Han,C.Y., Bernstein,D.A., Hsiao,W., Lin,B.K. and Hardy,S. (1994) Ethnic distribution of the glutathione transferase Mu 1-1 (GSTM1) null genotype in 1473 individuals and application to bladder cancer susceptibility. Carcinogenesis, 15, 1077–1081.[Abstract/Free Full Text]

    Lindros,K.O. (1995) Alcoholic liver disease: pathobiological aspects. J. Hepatol., 1 (Suppl. 23), 7–15.

    Longnecker,M.P. (1995) Alcohol consumption and risk of cancer in humans: an overview. Alcohol, 12, 87–96.[CrossRef][Web of Science][Medline]

    Lucas,D., Menez,C., Floch,F. et al. (1996) Cytochromes P4502E1 and P4501A1 genotypes and susceptibility to cirrhosis or upper aerodigestive tract cancer in alcoholic caucasians. Alcohol Clin. Exp. Res., 20, 1033–1037.[CrossRef][Web of Science][Medline]

    Maezawa,Y., Yamauchi,M. and Toda,G. (1994) Association between restriction fragment length polymorphism of the human cytochrome P450IIE1 gene and susceptibility to alcoholic liver cirrhosis. Am. J. Gastroenterol., 89, 561–565.[Web of Science][Medline]

    Maruyama,K., Takahashi,H., Matsushita,S. et al. (1999) Genotypes of alcohol-metabolizing enzymes in relation to alcoholic chronic pancreatitis in Japan. Alcohol Clin. Exp. Res., 23 (Suppl. 4), 85S–91S.[CrossRef][Web of Science][Medline]

    Matthias,C., Bockmuhl,U., Jahnke,V. et al. (1998) Polymorphism in cytochrome P450 CYP2D6, CYP1A1, CYP2E1 and glutathione S-transferase, GSTM1, GSTM3, GSTT1 and susceptibility to tobacco-related cancers: studies in upper aerodigestive tract cancers. Pharmacogenetics, 8, 91–100.[Web of Science][Medline]

    Matthias,C., Jahnke,V., Fryer,A.A. and Strange,R.C. (2002) First results on the influence of polymorphisms at glutathione S-transferase, cytochrome P450 and tumor necrosis factor gene loci on the development of multiple head and neck cancer. Laryngorhinootologie, 82, 25–30.[CrossRef]

    McBride,O.W., Umeno,M., Gelboin,H.V. and Gonzalez,F.J. (1987) A TaqI polymorphism in the human P450IIE1 gene on chromosome 10 (CYP2E). Nucleic Acids Res., 15, 10071.[Free Full Text]

    Mitrunen,K., Jourenkova,N., Kataja,V., Eskelinen,M., Kosma,V.M., Benhamou,S., Vainio,H., Uusitupa,M. and Hirvonen,A. (2001) Glutathione S-transferase M1, M3, P1 and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol. Biomarkers Prev., 10, 229–236.[Abstract/Free Full Text]

    Nelson,H.H., Wiencke,J.K., Christiani,D.C. et al (1995) Ethnic differences in the prevalence of the homozygous deleted genotype of glutathione S-transferase theta. Carcinogenesis, 16, 1243–1245.[Abstract/Free Full Text]

    Oinonen,T. and Lindros,K.O. (1995) Hormonal regulation of the zonated expression of cytochrome P-450 3A in rat liver. Biochem. J., 309, 17–35.

    Pavanello,S. and Clonfero,E. (2000) Biological indicators of genotoxic risk and metabolic polymorphisms. Mutat. Res., 463, 285–308.[CrossRef][Web of Science][Medline]

    Rodrigo,L., Alvarez,V., Rodriguez,M., Perez,R., Alvarez,R. and Coto,E. (1999) N-acetyltransferase-2, glutathione S-transferase M1, alcohol dehydrogenase and cytochrome P450IIE1 genotypes in alcoholic liver cirrhosis: a case–control study. Scand. J. Gastroenterol., 34, 303–307.[CrossRef][Web of Science][Medline]

    Ryberg,D., Skaug,V., Hewer,A., Phillips,D.H., Harries,L.W., Wolf,C.R., Ogreid,D., Ulvik,A., Vu,P. and Haugen,A. (1997) Genotypes of glutathione transferase M1 and P1 and their significance for lung DNA adduct levels and cancer risk. Carcinogenesis, 18, 1285–1289.[Abstract/Free Full Text]

    Savolainen,V.T., Liesto,K., Mannikko,A., Penttila,A. and Karhunen,P.J. (1993) Alcohol consumption and alcoholic liver disease: evidence of a threshold level of effects of ethanol. Alcohol Clin. Exp. Res., 17, 1112–1117.[Web of Science][Medline]

    Savolainen,V., Perola,M., Lalu,K., Penttila,A., Virtanen,I. and Karhunen,P.J. (1995) Early perivenular fibrogenesis—precirrhotic lesions among moderate alcohol consumers and chronic alcoholics. J. Hepatol., 23, 524–531.[CrossRef][Web of Science][Medline]

    Savolainen,V.T., Pjarinen,J., Perola,M., Penttila,A. and Karhunen,P.J. (1996) Glutathione-S-transferase GST M1 ‘‘null’’ genotype and the risk of alcoholic liver disease. Alcohol Clin. Exp. Res., 20, 1340–1345.[CrossRef][Web of Science][Medline]

    Schnakenberg,E., Breuer,R., Werdin,R., Dreikorn,K. and Schloot,W. (2000) Susceptibility genes: GSTM1 and GSTM3 as genetic risk factors in bladder cancer. Cytogenet. Cell Genet., 91, 234–238.[CrossRef][Web of Science][Medline]

    Seidegard,J., Voracheck,W.R., Pero,R.W. and Pearson,W.R. (1986) Hereditary differences in the expression of the human glutathione transferase activity on trans-stilbene oxide are due to a gene deletion. Proc. Natl Acad. Sci. USA, 85, 7293–7297.

    Setiawan,V.W., Zhang,Z.F., Yu,G.P. et al. (2001) GSTP1 polymorphisms and gastric cancer in a high-risk Chinese population. Cancer Causes Control, 12, 673–681.[CrossRef][Web of Science][Medline]

    Sorensen,T.I., Orholm,M., Bentsen,K.D., Hoybye,G., Eghoje,K. and Christoffersen,P. (1984) Prospective evaluation of alcohol abuse and alcoholic liver injury in men as predictors of development of cirrhosis. Lancet, 2, 241–244.[CrossRef][Web of Science][Medline]

    Standop,J., Ulrich,A.B., Schneider,M.B., Büchler,M.W. and Pour,P.M. (2002) Differences in the expression of xenobiotic-metabolizing enzymes between islets derived from the ventral and dorsal anlage of the pancreas. Pancreatology, 2, 510–518.[CrossRef][Web of Science][Medline]

    Stephens,E.A., Taylor,J.A., Kaplan,N., Yang,C.H., Hsieh,L.L., Lucier,G.W. and Bell,D.A. (1994) Ethnic variation in the CYP2E1 gene: polymorphism analysis of 695 African-Americans, European-Americans and Taiwanese. Pharmacogenetics, 4, 185–192.[Web of Science][Medline]

    Takahashi,T., Lasker,J.M., Rosman,A.S. and Lieber,C.S. (1993) Induction of cytochrome P-4502E1 in the human liver by ethanol is caused by a corresponding increase in encoding messenger RNA. Hepatology, 17, 236–245.[CrossRef][Web of Science][Medline]

    Tefre,T., Ryberg,D., Haugen,A., Nebert,D.W., Skaug,V., Brogger,A. and Borresen,A.L. (1991) Human CYP1A1 (cytochrome P(1)450) gene: lack of association between the MspI restriction fragment length polymorphism and incidence of lung cancer in a Norwegian population. Pharmacogenetics, 1, 20–25.[Medline]

    Terelius,Y., Lindros,K.O., Albano,E. and Ingelman-Sundberg,M. (1978) Isozyme specificity of cytochrome P450-mediated hepatotoxicity. In Rein,H. and Ruckpaul,K. (eds), Frontiers of Biotransformation. Akademie Verlag, Berlin, Vol. 8, pp. 186–233.

    Tsutsumi,M., Takada,A. and Wang,J.S. (1994) Genetic polymorphisms of cytochrome P4502E1 related to the development of alcoholic liver disease. Gastroenterology, 107, 1430–1435.[Web of Science][Medline]

    Uematsu,F., Kikuchi,H., Motomiya,M., Abe,T., Sagami,I., Ohmachi,T., Wakui,A., Kanamaru,R. and Watanabe,M. (1991) Association between restriction fragment length polymorphism of the human cytochrome P450IIE1 gene and susceptibility to lung cancer. Jpn. J. Cancer Res., 82, 254–256.[CrossRef][Web of Science]

    Vanhaecke,T., Lindros,K.O., Oinonen,T., Coecke,S., Debast,G., Phillips,I.R., Shephard,E.A., Vercrayne,A. and Rogiers,V. (2000) Effect of ethanol on the expression of hepatic glutathione S-transferase: an in vivo/in vitro study. Biochem. Pharmacol., 60, 1491–1496.[CrossRef][Web of Science][Medline]

    Wacke,R., Kirchner,A., Prall,F. et al. (1998) Up-regulation of cytochrome P450 1A2, 2C9 and 2E1 in chronic pancreatitis. Pancreas, 16, 521–528.[Web of Science][Medline]

    Watson,M.A., Stewart,R.K., Smith,G.B., Massey,T.E. and Bell,D.A. (1998) Human glutathione S-transferase P1 polymorphisms: relationship to lung tissue enzyme activity and population frequency distribution. Carcinogenesis, 19, 275–280.[Abstract/Free Full Text]

Received on October 27, 2003; revised and accepted on March 30, 2004;


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nicotine Tob ResHome page
X. Chen and K. J. Woodcroft
Polymorphisms in metabolic genes CYP1A1 and GSTM1 and changes in maternal smoking during pregnancy
Nicotine Tob Res, March 1, 2009; 11(3): 225 - 233.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Rossini, D.C.M. Rapozo, S.C. Soares Lima, D.P. Guimaraes, M.A. Ferreira, R. Teixeira, C.D.P. Kruel, S.G.S. Barros, N.A. Andreollo, R. Acatauassu, et al.
Polymorphisms of GSTP1 and GSTT1, but not of CYP2A6, CYP2E1 or GSTM1, modify the risk for esophageal cancer in a western population
Carcinogenesis, December 1, 2007; 28(12): 2537 - 2542.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
C. H. Osterreicher, J. Schultheiss, M. Wehler, N. Homann, C. Hellerbrand, B. Kunzli, H. Friess, H. K. Seitz, and F. Stickel
Genetic polymorphisms of manganese-superoxide dismutase and glutathione-S-transferase in chronic alcoholic pancreatitis
Mutagenesis, September 1, 2007; 22(5): 305 - 310.
[Abstract] [Full Text] [PDF]


Home page
Alcohol AlcoholHome page
F. STICKEL and C. H. OSTERREICHER
THE ROLE OF GENETIC POLYMORPHISMS IN ALCOHOLIC LIVER DISEASE
Alcohol Alcohol., May 1, 2006; 41(3): 209 - 224.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (28)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burim, R. V.
Right arrow Articles by Takahashi, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burim, R. V.
Right arrow Articles by Takahashi, C. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?