Mutagenesis Advance Access originally published online on January 25, 2005
Mutagenesis 2005 20(1):39-44; doi:10.1093/mutage/gei006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mutagenesis vol. 20 no. 1 © UK Environmental Mutagen Society 2005; all rights reserved.
Extreme cytotoxicity and susceptibility to hprt mutagenesis in Ku-deficient xrs-6 cells treated with bleomycin in plateau phase
Department of Pharmacology and Toxicology, Virginia Commonwealth University, Richmond, VA 23298-0230, USA
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In an attempt to determine the possible role of Ku-dependent end joining in mutagenesis resulting from DNA double-strand breaks, mutations induced by bleomycin at the hprt locus in plateau phase normal CHO-K1 and Ku-deficient xrs-6 cells were examined. Plateau phase xrs-6 cells were 500-fold more sensitive to chronic bleomycin treatment than were CHO-K1 cells. XRCC4-deficient XR-1 cells were
100-fold and DNA-PKcs-deficient XR-C1 and V-3 cells 15- to 30-fold more sensitive than CHO-K1 cells. These hypersensitivities are much greater than those previously reported for acute treatments with bleomycin or ionizing radiation. While the induced mutation frequencies at comparable levels of survival were slightly lower in xrs-6 cells, mutations were induced by bleomycin at much lower concentrations in xrs-6 than in CHO-K1 cells. For both cell lines bleomycin treatment resulted in a marked increase in the incidence of complete hprt deletions, while point mutations in hprt cDNA were rare. The results suggest that bleomycin-induced double-strand breaks tend to generate very large deletions in both cell lines and that this effect occurs at much lower levels of double-strand breaks in Ku-deficient than in normal cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In nearly all studies of mutagenesis by ionizing radiation and other double-strand cleaving agents large-scale (>1 kb) deletions and rearrangements account for a substantial portion, often a majority, of the induced mutations (Sankaranarayanan, 1991
; Fuscoe et al., 1992; Little, 1993; Schwartz et al., 1994; Thacker, 1999). The detailed mechanisms by which these mutations arise are not known, but it has often been proposed that they result from misrepair of DNA double-strand breaks (DSBs) (Miles et al., 1990; Morris and Thacker, 1993; Thacker, 1999). In order to test this hypothesis, we previously analyzed aprt mutations induced in plateau phase Chinese hamster ovary (CHO) cells by the radiomimetic agent bleomycin (Povirk et al., 1994), which produces site-specific, free radical-mediated DSBs. Unexpectedly, no large-scale deletions were detected. Instead, the spectrum was dominated by single base pair (–1) deletions, with a small fraction of highly conservative interchromosomal reciprocal translocations. Nevertheless, the sequence specificity of these events suggested that in both cases they resulted from errors in DSB rejoining (Povirk et al., 1994; Wang et al., 1997), and thus we sought to determine whether they were dependent on the major DNA end joining pathway involving Ku, XRCC4 and DNA ligase IV (Valerie and Povirk, 2003). However, although several Ku-deficient CHO cell lines have been isolated (Collins, 1993), no aprt hemizygous line is available for mutagenesis studies at that locus. Therefore, we have examined hprt mutations induced by bleomycin in plateau phase normal CHO-K1 cells and in the Ku-deficient derivative xrs-6 (Jeggo and Kemp, 1983), in order to determine whether translocations similar to those seen at the aprt locus could be detected and if so whether they were Ku-dependent. |
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Cell lines
CHO-K1 and xrs-6 cells were from the European Collection of Cell Culture. XR-1 cells were from the Coriell Cell Repository. XR-C1 cells were generously provided by M.Z.Zdzienicka (University of Leiden) and V-3 cells by D.J.Chen (Lawrence Berkeley Laboratory).
Survival and mutagenesis
Monolayer cultures of CHO-K1 cells and various repair-deficient mutants were grown in 
MEM plus 5% fetal bovine serum, 2.5% horse serum and antibiotics (Gibco). For each experiment, cells were grown to plateau phase in 6-well plates in 5 ml of medium containing hypoxanthine, aminopterin and thymidine (HAT supplement; Gibco) to eliminate pre-existing hprt mutants. The medium was replaced with normal conditioned medium and then the cells were treated with bleomycin for 2 days, with one change of medium after 24 h (see Povirk et al., 1994, for details). After incubation for 4 h in drug-free conditioned medium, cells were plated at 800–20 000 cells per 100 mm dish to determine survival. Flow cytometry (not shown) indicated that at the start of drug treatment 75% of CHO-K1 cells and 76% of xrs-6 cells were in G1/G0 phase, compared with 28% and 32%, respectively, in exponentially growing cultures, and there was no evidence of a G2 block in plateau phase cultures of either cell line.
For mutagenesis experiments plateau phase cells treated with bleomycin as above were trypsinized, plated at 2 x 106 per 100 mm dish and grown for 9–12 days to allow mutant expression. When cells reached confluence, but no sooner than 3 days after plating, they were replated at the same density and again grown to confluence. After a second replating and growth to confluence cells were plated for mutant selection at 2 x 105 per dish, with four dishes per treated culture, in medium containing dialyzed serum and 20 µM 6-thioguanine.
Mutant analysis
Mutant colonies were isolated from untreated cultures and from treated cultures that yielded a mutation frequency of at least 4 x 10–5. Each mutant clone was expanded and RNA was isolated from one confluent 100 mm dish using RNAstat reagent (Tel-Test, Friendswood, TX). cDNA was prepared and hprt cDNA was amplified and sequenced as described by Yu et al. (1992). For mutants that yielded no PCR product, the cDNA was subjected to PCR with the primers TGTTCCCGGACTGGTATGAC and CTGGTGGCTCACAAAGGTCA, which amplify a 694 bp segment of aprt mRNA, in order to verify that full-length cDNAs had been synthesized.
In order to screen cDNA-negative mutants for large deletions and rearrangements, genomic DNA was prepared from each mutant (Grosovsky et al., 1986), cut with HindIII or EcoRI and subjected to Southern blotting with a PCR-generated probe consisting of bp 23–649 of the hprt cDNA. Each of these enzymes generates two large hprt fragments encompassing exons 2–4 and exons 6–9 (Rossiter et al., 1991). Mutants that showed no change in HindIII or EcoRI digests were subjected to Southern blotting with BamHI to screen for alterations in the region encompassing exon 5. Mutants which still showed no detectable changes were subjected to PCR to screen for alterations in the area of exon 1, which are difficult to detect by Southern blotting (Köberle and Speit, 1991; Rossiter et al., 1991).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Cytotoxicity
The xrs-6 derivative of CHO-K1 was initially isolated on the basis of sensitivity to ionizing radiation and was subsequently shown to be cross-sensitive to bleomycin (Jeggo and Kemp, 1983
). Under the conditions used in the present study, i.e. treatment of cells for 2 days in plateau phase, the sensitivity of xrs-6 cells to bleomycin was extreme (Figure 1A and B), 500-fold greater than that of the parental line (10% survival at 0.04 and 20 µM, respectively). To determine whether this was a peculiarity of the xrs-6 line, other CHO derivatives defective in non-homologous end joining were also examined. XR-1 cells, which are genetically deficient in XRCC4 and also lack detectable DNA ligase IV (Li and Alt, 1996; Bryans et al., 1999), were about 100-fold more sensitive than CHO-K1 cells. V-3 cells, which lack the catalytic subunit (DNA-PKcs) of DNA-dependent protein kinase (DNA-PK), were 30-fold more sensitive (Peterson et al., 1995). XR-C1 cells, which also lack DNA-PKcs but were derived from CHO9 cells (Errami et al., 1998), were 15-fold more sensitive. In each case these hypersensitivities, while not as great as that of xrs-6, were significantly greater than those previously reported for the same cell lines when treated with acute single doses of radiation or bleomycin [typically 3- to 6-fold and rarely more than 10-fold (Jeggo and Kemp, 1983; Whitmore et al., 1989; Errami et al., 1998)]. Thus, chronic treatment in plateau phase accentuates the bleomycin sensitivity of end joining mutants. However, survival curves for all the mutants showed some upward concavity, which would be consistent with a resistant subpopulation of cells.
|
), XR-C1 (•), V-3 (
), XR-1 (
) or xrs-6 (
) cells were treated with bleomycin for 2 days in plateau phase and clonogenic survival was determined (A and B). Each point is the mean ± SD from 5–6 experiments (CHO-K1 and xrs-6), the mean ± range for 2 experiments (V-3, XR-C1) or a single experiment (XR-1). Mutagenesis following the same treatment was determined in CHO-K1 cells (C) and xrs-6 cells (D). Each point is the mean mutant frequency ± SE from 10 experiments with 2–3 treated cultures at each drug concentration per experiment.Mutagenesis
As reported previously for the similar Ku-deficient xrs-5 cell line (Schwartz et al., 1996
), the level of spontaneous mutagenesis in xrs-6 cells was similar to that of the parental cells, in our hands 1.5 mutant per 105 surviving cells. In bleomycin-treated CHO-K1 cells the mutant frequency reached a maximum of 8 x 10–5, or about 6 times the background frequency (Figure 1C). In xrs-6 cells an increased mutant frequency was seen at much lower bleomycin concentrations (Figure 1D); for example at 0.05 µM the mutant frequency was 4.7 ± 1.2 x 10–5 in xrs-6 cells, but was 1.3 ± 0.3 x 10–5, indistinguishable from the control, in CHO-K1 cells. However, at bleomycin concentrations giving equivalent levels of survival, the mutant frequency was 2-fold lower in xrs-6 than in CHO-K1 cells and only 2–3 times greater than the spontaneous frequency. In both cell lines the concentration dependence for mutagenesis was slightly sigmoidal, consistent with a saturable response. As previously seen with human cells (Yu et al., 2002), the variability in mutant frequency between individual treated cultures was unexpectedly large, particularly at the highest bleomycin concentrations. For this reason, mutant frequency was determined separately for each treated culture and clones for mutation analysis were taken only from cultures with a mutant frequency 
4 x 10–5, in order to maximize the probability that each mutant analyzed was bleomycin induced. Mutants were selected over the range of bleomycin concentrations that gave 10–50% survival with approximately equal numbers from each concentration shown in Figure 1C and D; there were no statistically significant differences in the types of mutations found in low versus high concentration mutants (data not shown).
Mutation spectra
Each mutant was initially screened by RT–PCR for the presence of hprt cDNA and each such cDNA was sequenced. In contrast to human mammary epithelial cells, where the great majority of HPRT mutants induced by bleomycin under essentially identical conditions yielded full-length cDNA (Yu et al., 2002), only 40% of the mutants from xrs-6 cells and 10% of those from CHO-K1 cells yielded hprt cDNA (Table I). Of the cDNA alterations in CHO-K1 cells (Table II), two were –1 deletions at potential sites of blunt-ended bleomycin-induced DSBs (Povirk et al., 1989). Such –1 deletions were the predominant type of bleomycin-induced mutation detected previously at the aprt locus and probably represent direct end joining repair of the DSBs, with deletion of the base pair initially destroyed in formation of the break (Povirk et al., 1994). cDNA alterations in xrs-6 cells were mostly exon skipping, consistent with either point mutations in splice junctions or small deletions involving single exons. The few base substitutions showed no apparent targeting to known bleomycin-induced DNA lesions, i.e. strand breaks and abasic sites at GC and GT sequences (Povirk, 1996). Remarkably, whereas the majority of spontaneous mutations in CHO-K1 cells were base substitutions (Xu et al., 1995), not a single substitution mutant was detected in CHO-K1 cells following bleomycin treatment.
|
|
Of the remaining cDNA-negative mutants, 20 from CHO-K1 and 21 from xrs-6 were chosen at random and subjected to Southern blotting to screen for large-scale deletions and rearrangements (Figure 2 and Table IV). Southern blotting rather than multiplex PCR of individual exons was chosen for this analysis because the previously determined aprt spectrum (Povirk et al., 1994
; Wang et al., 1997) suggested that many of the mutations might be conservative reciprocal translocations, most of which would likely not be detected by multiplex PCR. Contrary to this prediction, large-scale rearrangements of any kind were rare in CHO-K1 cells, as all but two of the 20 cDNA-negative mutants analyzed showed either a normal banding pattern or apparent loss of all hprt sequences (Table I). This is very different from the spectrum of spontaneous mutations in these cells, wherein only 4 of 64 were cDNA-negative and only one was a complete gene deletion (Xu et al., 1995). However, a large increase in incidence of complete hprt deletions was also seen following treatment of log phase V79 or CHO-K1 cells with bleomycin (Köberle and Speit, 1991; An and Hsie, 1993) or X-rays (Fuscoe et al., 1992). Complete deletions did not dominate these spectra to the extent seen in the present study, but in these earlier studies bleomycin increased the mutation frequency only 3-fold and thus spontaneous mutants would constitute a larger portion of the spectrum. The proportion of cDNA-negative thioguanine-resistant clones with a normal banding pattern was surprisingly high (Table I). These could include splicing mutants that produced mRNAs that were poorly amplified due to length, low abundance or heterogeneity, as well as clones wherein hprt may have been down-regulated by methylation or by changes in chromatin structure. Overall, the spectrum of hprt mutations induced in CHO-K1 cells by bleomycin in the plateau phase was more similar to that reported for bleomycin-treated log phase cells (Köberle and Speit, 1991; An and Hsie, 1993; An et al., 1998) than to our previous aprt spectrum (Povirk et al., 1994; Wang et al., 1997), suggesting that the unique properties of the aprt spectrum were due primarily to the choice of locus rather than to the treatment protocol.
|
, pseudogene band.
|
For xrs-6 cells only half of the large-scale alterations were complete deletions. The remainder showed altered banding patterns (Figure 2), suggesting large deletions or rearrangements with at least one breakpoint within hprt. These included mutants in which substantial portions of hprt were deleted as well as mutants in which most of hprt was retained, as summarized in Table IV. Because the mutagenesis protocol used in these experiments differed substantially from that of previous work, 23 mutants from untreated xrs-6 cells were also analyzed (Tables I and III). These mutants comprised a mixture of point mutations and large deletions/rearrangements and were thus similar to the mutants from bleomycin-treated cells, except that among the spontaneous mutants complete hprt deletions were rare (1 of 23). Since bleomycin treatment increased the overall mutant frequency only 2- to 3-fold and the fraction of partial hprt deletions/rearrangements was
1.5-fold greater in the spontaneous spectrum, it may be inferred that a substantial fraction and perhaps even a majority of partial hprt deletions in bleomycin-treated cells were actually of spontaneous origin.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The extreme sensitivity of xrs-6 cells and other DSB repair-deficient CHO lines to bleomycin in the plateau phase (Figure 1) is likely due to a combination of factors. First, as has been clearly shown for radiosensitivity (Stamato et al., 1983
; Whitmore et al., 1989), bleomycin sensitivity of these lines is likely to be most severe in G1/G0, when cells are most dependent on the Ku-dependent DSB repair pathway (Lee et al., 1997; Takata et al., 1998). Second, cells with a deficiency in Ku and other end joining factors lack split dose recovery (Whitmore et al., 1989; Mothersill and Seymour, 1993). Thus, at low bleomycin concentrations the steady-state level of DSBs in normal cells may be below the threshold of cytotoxic damage, whereas in end joining-deficient cells lethal damage may gradually accumulate throughout the treatment period. Finally, even in log phase xrs-6 cells are more sensitive to bleomycin (13-fold) than other Ku-deficient cells (xrs-1 and xrs-4), suggesting that its sensitivity may be due in part to factors other than repair, such as greater uptake or slower inactivation of bleomycin in xrs-6 cells (Jeggo and Kemp, 1983). Nevertheless, it is unlikely that all the DSB-deficient lines, which were also extremely bleomycin-sensitive, would share these features. It thus appears that the chronic plateau phase treatment protocol greatly accentuates the hypersensitivity of end joining mutants and, therefore, could be useful for detecting subtle repair defects that might not be detected with acute treatments, even in synchronized cells.
With respect to bleomycin-induced mutagenesis, deletions and rearrangements induced by radiation and other double-strand cleaving agents are generally attributed to errors in DSB repair (Miles et al., 1990; Morris and Thacker, 1993; Thacker, 1999), but even in cases where the precise sequence alterations are known, it has rarely been possible to determine the precise mechanisms by which they were formed. In the case of bleomycin-induced reciprocal translocations at the hemizygous aprt locus of CHO-D422 cells, however, it was possible to infer, at single nucleotide resolution, the detailed end-processing and joining events by which the mutations were generated, due to the conservative nature of the rearrangements and the sequence specificity of the DSBs (Wang et al., 1997). This analysis suggested that even when incorrect DNA ends are joined, there is relatively little resection or nucleotide addition other than gap filling at the DSB ends. Blunt ends, in particular, almost always appeared to retain all terminal nucleotides in the final repair joints. These events were, however, much more conservative than those detected in other studies of bleomycin- or radiation-induced mutagenesis (Breimer et al., 1986; Grosovsky et al., 1986; Sankaranarayanan, 1991; Schwartz et al., 1994), including two studies of bleomycin-induced hprt mutagenesis in CHO-K1 cells (Köberle and Speit, 1991; An and Hsie, 1993; An et al., 1998). The reason(s) for this difference has remained uncertain, but the obvious possibilities are the choice of locus and the use of plateau versus log phase cells.
The current study was undertaken in part to determine whether this highly conservative processing was dependent on Ku, a key component of the non-homologous end joining pathway of DSB repair. Because a Ku-deficient, aprt hemizygous cell strain was not available and our own efforts to generate such a strain have been unsuccessful, we instead examined mutagenesis at the hprt locus in normal CHO-K1 and Ku-deficient xrs-6 cells. In plateau phase CHO-D422 cells, which are hemizygous for aprt, 10% of bleomycin- and neocarzinostatin-induced aprt mutations were reciprocal translocations (Wang et al., 1997, 2002) and these were the only large-scale gene alterations detected. Because the target for reciprocal translocations in hprt is 20 times larger than in aprt (40 versus 2 kb), it was anticipated that while hprt translocations might be more difficult to analyze, they would probably be much more frequent and would likely constitute a substantial fraction, perhaps even a majority, of the total mutations. On the contrary however, translocations in hprt appeared to be quite rare in bleomycin-treated CHO-K1 cells, as inferred from the lack of mutants with altered Southern banding patterns. Conversely, complete gene deletions, absent entirely from the aprt spectrum (Povirk et al., 1994; Wang et al., 1997), dominated the hprt spectrum in normal cells. The lack of bleomycin-induced large deletions in aprt may be explained at least in part by the presence of an essential gene flanking the 3'-end of aprt (Grosovsky et al., 1986). With respect to the near absence of translocations at the hprt locus, cytogenetic studies have indicated that in human cells the X chromosome is significantly less susceptible than autosomes to radiation-induced reciprocal translocations (Seabright, 1973; Jordan and Schwartz, 1994). The present data suggest that the X chromosome in CHO cells may likewise be relatively immune to bleomycin-induced translocations. Such immunity would imply that at least some DSBs are processed differently in the X chromosome than in the rest of the genome and that, for agents that induce DSBs, reciprocal translocations may be a more important source of mutations than would be apparent from hprt mutation spectra.
In xrs-6 cells large deletions and rearrangements in which part of hprt was retained were more common than in CHO-K1 cells. These large deletions are presumably related in some way to Ku deficiency and could be the result of extensive nucleolytic degradation of DNA ends prior to rejoining, degradation that perhaps normally would have been prevented by binding of Ku or DNA-PK holoenzyme (Ku plus DNA-PKcs) to the ends. If this is indeed the mechanism, DSBs resulting from bleomycin treatment would be expected to increase the incidence of these mutations. Unfortunately, because of the relatively small bleomycin-induced increase in overall mutation frequency, the diversity of the mutation spectra and the large fraction of partial deletions in the spontaneous spectrum, a much larger sample of mutants from both treated and untreated cells would have to be analyzed in order to determine whether bleomycin-induced partial deletions were more common in xrs-6 than in CHO-K1 cells. What can be stated with reasonable confidence is that, in both cell lines, bleomycin tends to induce complete hprt deletions and that this effect occurs at much lower levels of damage in xrs-6 cells. Thus, the results are consistent with the proposal that DSBs are much more likely to trigger very large deletions in Ku-deficient cells, perhaps as a result of error-prone repair. However, the possibility that such deletions represent an induced global genomic instability (Murnane, 1996; Morgan, 2003), rather than aberrant DSB repair events, cannot be excluded and indeed such a mechanism would be consistent with the apparent saturability of the dose–response curve for mutagenesis (Figure 1C and D).
While quite common in CHO-K1 cells, complete hprt deletions were not detected in human 184B5 mammary epithelial cells treated with bleomycin under very similar conditions and were very rare even in a p53-deficient 184B5 derivative (Yu et al., 2002). These results suggest that either human cells are intrinsically resistant to this type of mutation or that the presence of the second, inactive X chromosome in 184B5 cells conferred protection against it, perhaps by channeling potentially mutagenic DSBs into a homologous recombination repair pathway. Whatever the molecular origin of the hprt mutations, it appears that in retrospect the unique, highly conservative nature of the bleomycin- and neocarzinostatin-induced rearrangements in the aprt gene (Povirk et al., 1994; Wang and Povirk, 1997; Wang et al., 1997, 2002) is attributable more to the choice of locus than to the use of plateau phase cells.
|
Acknowledgments |
|---|
This work was supported by grant CA40615 from the National Cancer Institute, US DHHS.
|
Notes |
|---|
* To whom correspondence should be addressed at: Virginia Commonwealth University, PO Box 980230, 1101 East Marshall Street, Richmond, VA 23298-0230, USA. Tel: +1 804 828 9640; Fax: +1 804 828 8079; Email: ruzhou{at}hsc.vcu.edu
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
-
An,J. and Hsie,A.W. (1993) Polymerase chain reaction-based deletion screening of bleomycin induced 6-thioguanine-resistant mutants in Chinese hamster ovary cells: the effects of an inhibitor and a mimic of superoxide dismutase. Mutat. Res., 289, 215–222.[Web of Science][Medline]
An,J., Trieff,N.M. and Hsie,A.W. (1998) PCR-directed DNA sequencing of "nondeletion" HPRT-mutants induced by bleomycin in CHO K1-BH4 cells. Environ. Mol. Mutagen., 32, 244–250.[CrossRef][Web of Science][Medline]
Breimer,L.H., Nalbantoglu,J. and Meuth,M. (1986) Structure and sequence of mutations induced by ionizing radiation at selectable loci in Chinese hamster ovary cells. J. Mol. Biol., 192, 669–674.[CrossRef][Web of Science][Medline]
Bryans,M., Valenzano,M.C. and Stamato,T.D. (1999) Absence of DNA ligase IV protein in XR-1 cells: evidence for stabilization by XRCC4. Mutat. Res., 433, 53–58.[Web of Science][Medline]
Collins,A.R. (1993) Mutant rodent cell lines sensitive to ultraviolet light, ionizing radiation and cross-linking agents: a comprehensive survey of genetic and biochemical characteristics. Mutat. Res., 293, 99–118.[CrossRef][Web of Science][Medline]
Errami,A., He,D.M., Friedl,A.A. et al. (1998) XR-C1, a new CHO cell mutant which is defective in DNA-PKcs, is impaired in both V(D)J coding and signal joint formation. Nucleic Acids Res., 26, 3146–3153.
Fuscoe,J.C., Zimmerman,L.J., Fekete,A., Setzer,R.W. and Rossiter,B.J. (1992) Analysis of X-ray-induced HPRT mutations in CHO cells: insertion and deletions. Mutat. Res., 269, 171–183.[CrossRef][Web of Science][Medline]
Grosovsky,A.J., Drobetsky,E.A., deJong,P.J. and Glickman,B.W. (1986) Southern analysis of genomic alterations in gamma-ray-induced aprt–hamster cell mutants. Genetics, 113, 405–415.
Jeggo,P.A. and Kemp,L.M. (1983) X-ray-sensitive mutants of Chinese hamster ovary cell line. Isolation and cross-sensitivity to other DNA damaging agents. Mutat. Res., 112, 313–327.[Web of Science][Medline]
Jordan,R. and Schwartz,J.L. (1994) Noninvolvement of the X chromosome in radiation-induced chromosome translocations in the human lymphoblastoid cell line TK6. Radiat. Res., 137, 290–294.[Web of Science][Medline]
Köberle,B. and Speit,G. (1991) Molecular characterization of mutations at the hprt locus in V79 Chinese hamster cells induced by bleomycin in the presence of inhibitors of DNA repair. Mutat. Res., 249, 161–167.[Web of Science][Medline]
Lee,S.E., Mitchell,R.A., Cheng,A. and Hendrickson,E.A. (1997) Evidence for DNA-PK-dependent and -independent DNA double-strand break repair pathways in mammalian cells as a function of the cell cycle. Mol. Cell. Biol., 17, 1425–1433.[Abstract]
Li,Z. and Alt,F.W. (1996) Identification of the XRCC4 gene: complementation of the DSBR and V(D)J recombination defects of XR-1 cells. Curr. Topics Microbiol. Immunol., 217, 143–150.[Web of Science][Medline]
Little,J.B. (1993) Cellular, molecular and carcinogenic effects of radiation. Hematol. Oncol. Clin. North Am., 7, 337–352.[Web of Science][Medline]
Miles,C., Sargent,G., Phear,G. and Meuth,M. (1990) DNA sequence analysis of gamma radiation-induced deletions and insertions at the APRT locus of hamster cells. Mol. Carcinog., 3, 233–242.[Web of Science][Medline]
Morgan,W.F. (2003) Non-targeted and delayed effects of exposure to ionizing radiation: II. Radiation-induced genomic instability and bystander effects in vivo, clastogenic factors and transgenerational effects. Radiat. Res., 159, 581–596.[CrossRef][Web of Science][Medline]
Morris,T. and Thacker,J. (1993) Formation of large deletions by illegitimate recombination in the HPRT gene of primary human fibroblasts. Proc. Natl Acad. Sci. USA, 90, 1392–1396.
Mothersill,C. and Seymour,C.B. (1993) Recovery of the radiation survival-curve shoulder in CHO-KI, XRS-5 and revertant XRS-5 populations. Mutat. Res., 285, 259–266.[CrossRef][Web of Science][Medline]
Murnane,J.P. (1996) Role of induced genetic instability in the mutagenic effects of chemicals and radiation. Mutat. Res., 367, 11–23.[CrossRef][Web of Science][Medline]
Peterson,S.R., Kurimasa,A., Oshimura,M., Dynan,W.S., Bradbury,E.M. and Chen,D.J. (1995) Loss of the catalytic subunit of the DNA-dependent protein kinase in DNA double-strand-break-repair mutant mammalian cells. Proc. Natl Acad. Sci. USA, 92, 3171–3174.
Povirk,L.F. (1996) DNA damage and mutagenesis by radiomimetic DNA-cleaving agents: bleomycin, neocarzinostatin and other enediynes. Mutat. Res., 355, 71–89.[Web of Science][Medline]
Povirk,L.F., Han,Y.-H. and Steighner,R.J. (1989) Structure of bleomycin-induced DNA double-strand breaks: predominance of blunt ends and single-base 5' extensions. Biochemistry, 28, 8508–8514.
Povirk,L.F., Bennett,R.A.O., Wang,P., Swerdlow,P.S. and Austin,M.J.F. (1994) Single base-pair deletions induced by bleomycin at potential double-strand cleavage sites in the aprt gene of stationary phase Chinese hamster ovary D422 cells. J. Mol. Biol., 243, 216–226.[CrossRef][Web of Science][Medline]
Rossiter,B.J., Fuscoe,J.C., Muzny,J.C., Fox,M. and Caskey,C.T. (1991) The Chinese hamster HPRT gene: restriction map, sequence analysis and multiplex PCR deletion screen. Genomics, 9, 247–256.[CrossRef][Web of Science][Medline]
Sankaranarayanan,K. (1991) Ionizing radiation and genetic risks. III. Nature of spontaneous and radiation-induced mutations in mammalian in vitro systems and mechanisms of induction of mutations by radiation. Mutat. Res., 258, 75–97.[CrossRef][Web of Science][Medline]
Schwartz,J.L., Rotmensch,J., Sun,J., An,J., Xu,Z., Yu,Y. and Hsie,A.W. (1994) Multiplex polymerase chain reaction-based deletion analysis of spontaneous, gamma ray- and alpha-induced hprt mutants of CHO-K1 cells. Mutagenesis, 9, 537–540.
Schwartz,J.L., Porter,R.C. and Hsie,A.W. (1996) The molecular nature of spontaneous mutations at the hprt locus in the radiosensitive CHO mutant xrs-5. Mutat. Res., 351, 53–60.[Web of Science][Medline]
Seabright,M. (1973) Noninvolvement of the human X chromosome in X-ray induced exchanges. Cytogenet. Cell Genet., 12, 342–356.[Web of Science][Medline]
Stamato,T.D., Weinstein,R., Giaccia,A. and Mackenzie,L. (1983) Isolation of cell cycle-dependent gamma ray-sensitive Chinese hamster ovary cell. Somat. Cell Genet., 9, 165–173.[Medline]
Thacker,J. (1999) Repair of ionizing radiation damage in mammalian cells. Alternative pathways and their fidelity. C. R. Acad. Sci. III, 322, 103–108.[Medline]
Takata,M., Sasaki,M.S., Sonoda,E., Morrison,C., Hashimoto,M., Utsumi,H., Yamaguchi-Iwai,Y., Shinohara,A. and Takeda,S. (1998) Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J., 17, 5497–5508.[CrossRef][Web of Science][Medline]
Valerie,K. and Povirk,L.F. (2003) Regulation and mechanisms of mammalian double-strand break repair. Oncogene, 22, 5792–5812.[CrossRef][Web of Science][Medline]
Wang,P. and Povirk,L.F. (1997) Targeted base substitutions and small deletions induced by neocarzinostatin at the APRT locus in plateau-phase CHO cells. Mutat. Res., 373, 17–29.[Web of Science][Medline]
Wang,P., Zhou,R.-H., Zou,Y., Jackson-Cook,C.K. and Povirk,L.F. (1997) Highly conservative reciprocal translocations formed by apparent joining of exchanged DNA double-strand break ends. Proc. Natl Acad. Sci. USA, 94, 12018–12023.
Wang,P., Lee,J.W., Turner,K., Zou,Y., Jackson-Cook,C.K. and Povirk,L.F. (2002) Rearrangements induced by the DNA double-strand cleaving agent neocarzinostatin: conservative nonhomologous reciprocal exchanges in an otherwise stable genome. Nucleic Acids Res., 30, 2639–2646.
Whitmore,G.F., Varghese,A.J. and Gulyas,S. (1989) Cell cycle responses of two X-ray sensitive mutants defective in DNA repair. Int. J. Radiat. Biol., 56, 657–665.[Web of Science][Medline]
Xu,Z., Yu,Y., Schwartz,J.L., Meltz,M.L. and Hsie,A.W. (1995) Molecular nature of spontaneous mutations at the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus in Chinese hamster ovary cells. Environ. Mol. Mutagen., 26, 127–138.[Web of Science][Medline]
Yu,Y.J., Xu,Z., Gibbs,R.A. and Hsie,A.W. (1992) Polymerase chain reaction-based comprehensive procedure for the analysis of the mutation spectrum at the hypoxanthine-guanine phosphoribosyltransferase locus in Chinese hamster cells. Environ. Mol. Mutagen., 19, 267–273.[Web of Science][Medline]
Yu,Y., Inamdar,K.V., Turner,K., Jackson-Cook,C.K. and Povirk,L.F. (2002) Base substitutions, targeted single-base deletions and reciprocal translocations induced by bleomycin in plateau-phase mammary epithelial cells. Radiat. Res., 158, 327–338.[CrossRef][Web of Science][Medline]
Received on August 8, 2004; revised on November 30, 2004; accepted on December 1, 2004.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||