Mutagenesis Advance Access originally published online on February 22, 2005
Mutagenesis 2005 20(2):93-100; doi:10.1093/mutage/gei012
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press on behalf of the UK Environmental Mutagen Society 2005
The stimulatory role of human cytochrome b5 in the bioactivation activities of human CYP1A2, 2A6 and 2E1: a new cell expression system to study cytochrome P450 mediated biotransformation
1Department of Genetics, Faculty of Medical Sciences, Universidade Nova de Lisboa, Rua da Junqueira 96, 1349-008 Lisboa, Portugal, 2Faculty of Science and Technology, Universidade Nova de Lisboa, Quinta da Torre, 2829-516 Caparica, Portugal and 3Institute of Bioorganic Chemistry, National Academy of Sciences, Minsk, Belarus
| Abstract |
|---|
|
|
|---|
Cytochrome b5 (b5) is increasingly recognized to be of importance for specific cytochrome P450 (CYP) activities. We developed human b5/CYP-competent mutagenicity tester bacteria to study the role of b5 in the bioactivation activity of human CYP. These new tester bacteria were derived from the previously engineered human CYP-competent Escherichia coli K12 tester strain MTC, containing a bi-plasmid system for the co-expression of a specific CYP form (CYP1A2, 2A6 or 2E1) with human b5, and human NADPH cytochrome P450 reductase (RED), resulting in the strain BTC-b5-1A2, BTC-b5-2A6 and BTC-b5-2E1, respectively. The relative content of b5 with CYP and RED in these three BTC-b5-CYP strains demonstrated physiologically relevant co-expression levels and typical CYP-specific activities could be determined with their specific chemical probes. These strains were applied in mutagenicity assays along with their corresponding b5-void strains to determine the effect of b5 on the CYP1A2-, CYP2A6- and CYP2E1-mediated bioactivation of several promutagens. For CYP1A2, of the 5 compounds tested [2-aminoanthracene (2AA), 1-aminopyrene, 6-aminochrysene, 2-amino-3-methylimidazo(4,5-f)quinoline and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)], only the mutagenicity of 2AA was slightly increased (
1.5-fold) in the presence of b5. The CYP2E1- and CYP2A6-dependent mutagenicity of N-nitrosodiethylamine increased
3- and 23-fold, respectively when the bacteria contained b5. The CYP2A6-mediated mutagenicity of NNK increased
9-fold when co-expressed with b5. The stimulatory effect of b5 on the bioactivation of N-nitrosodi-n-propylamine was most striking. The mutagenicity of this procarcinogen was completely dependent on the co-expression of b5 with CYP2A6 or CYP2E1. This demonstrates the prominent role of b5 in the bioactivation of this carcinogen. | Introduction |
|---|
|
|
|---|
Cytochrome P540 (CYP) enzymes catalyze the oxidation of a large number of endogenous compounds, constitute a major determinant of the half-life and pharmacological properties of therapeutic drugs and are involved in the bioactivation of many drugs, toxins and carcinogens to their ultimate reactive species (1
In vitro assays, using cell systems, which contain a discernible bioactivation parameter and simultaneously allow the expression of human biotransformation enzymes, are considered to be a valuable tool to evaluate the role of human biotransformation enzymes, in particular CYPs and their polymorphic forms in xenobiotic metabolism (5![]()
7
).
We reported previously on the development of a bi-plasmid system for the co-expression of human NADPH cytochrome P450 reductase (RED) with a particular human CYP form in Escherichia coli strain MTC (8
,9
) and BTC (M.P.Duarte, B.Brito Palma, A.Laires, J.Santos Oliveira, J.Rueff and M.Kranendonk, unpublished data). These strains were developed for the study of the role of individual CYPs in the bioactivation of chemicals to mutagens, monitored by the reversion to L-Arginine auxotrophy.
Lately, another heme protein is recognized to be of importance for the CYP-mediated reactions, namely cytochrome b5 (b5). The role of this protein in CYP reactions is thought to involve: (i) direct transfer of a rate-limiting electron, (ii) complexing with CYP to allow a two-electron transfer during a single interaction with RED, (iii) diminution of the extent of uncoupling or (iv) direct effector actions, enhancing product formation without redox changes of b5 (10
).
In vitro experiments, with purified recombinant enzymes or with cells co-expressing b5 with RED and CYP, showed that b5 could modulate specific activities of several CYPs. CYP3A4 (11![]()
![]()
14
), CYP2C9 (13
,14
), CYP2A6 (14
) and CYP2E1 (13![]()
![]()
![]()
17
) seem to be stimulated by b5 or, with the exception of CYP2E1, by apo-b5. In several cases, the effect of b5 is not only CYP-dependent but also substrate-dependent (11
). On analyzing the effects of apo-b5 on CYPs activities, it seems plausible that in addition to the involvement in electron transfer, b5 also plays a conformational role in the human CYP/RED complex (14
,18
). On the other hand, neither apo-b5 nor b5 seems to have any effect on CYP1A1, CYP1A2, CYP2D6 or CYP1B1 activities (14
).
Recently, two studies were published describing the co-expression of human b5 with CYP1A2 and CYP2E1 in a mutagenicity tester bacteria using Salmonella typhimurium LT2. The co-expression of human b5 with human CYP2E1 and rat RED increased the nitrosamine mutagenicity by as much as 5-fold (15
) and the co-expression of b5 with human CYP1A2 and human RED significantly enhanced the mutagenicity of 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ) (19
). But the expression level of b5 was not quantified, in both studies hampering the qualification of these systems for their physiological relevance.
The main goal of the present work was the study of the role of b5 on the bioactivation activities of human CYP1A2, 2A6 and 2E1 in physiologically relevant conditions. For this purpose, we developed a new mutagenicity tester strain (BTC-b5-CYP) co-expressing human b5 with human RED and a specific human CYP form (1A2, 2A6 or 2E1). The cDNA encoding human b5 was cloned in order to obtain low levels of b5 expression relative to CYP. These low levels of expression are important, not only to achieve physiologically relevant contents of b5, but also to avoid a possible competition between b5 and CYP for heme in the biosynthesis of these two cytochromes. Recently, it was observed that apo-b5 is able to remove the heme from CYP3A4 with the formation of holo-b5 and apo-CYP (20
), although others have refuted such a possibility (21
). The new strains (BTC-b5-1A2, BTC-b5-2A6 and BTC-b5-2E1) were evaluated for the expression levels of b5, CYP and RED, specific CYP enzymatic activities and studies of the role of b5 on the bioactivation of several procarcinogens by CYP1A2, 2A6 and 2E1.
| Materials and methods |
|---|
|
|
|---|
Reagents
L-Arginine,
-aminolevulinic acid, ampicillin, kanamycin sulphate, chloramphenicol, coumarin, 7-hydroxycoumarin, cytochrome C, isopropyl ß-D-thiogalactoside (dioxane-free) (IPTG), thiamine, chlorzoxazone, 6-hydroxychlorzoxazone, N-nitrosodiethylamine (NNdEA), N-nitrosodi-n-propylamine (NNdPA), 2-aminoanthracene (2AA), 1-aminopyrene (1AP), 6-aminochrysene (6AC) and human recombinant histidine-tagged b5 were obtained from Sigma Chemical Co. (St Louis, MO). 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) were obtained from Toronto Research Chemicals Inc. (North York, Ontario, Canada). Bacto agar, bacto peptone and bacto yeast extract were from Difco (Detroit, MI). All other chemicals were of the highest quality.
Strains, plasmids and cultures
Strains and plasmids used in this study are presented in Table I. Cloning of human b5 was carried out as follows. The cDNA encoding human b5 was amplified from plasmid pT7-7 (22
), excluding the histidine tag region. The cDNA of human b5 was amplified by PCR using the following primers: GATGAATTCATATGGCAGAGCAGTCGG and CTAGAATTCTCTCCTTGGTCGA CTCTAGAGG. These primers introduced an EcoRI site (underlined sequence) upstream and downstream of the b5 coding sequence. The amplification product was ligated in the pGEM-T vector (Promega). The cDNA sequence was verified by automatic sequencing (ABI 310). Finally, the EcoRI insert containing the cDNA for human b5 was cloned in the EcoRI-digested pLCMhOR (8
), generating plasmid pLCM-b5-RED (Figure 1). The correct orientation was confirmed by a restriction analysis.
|
|
The development of strains BTC0, BTC1A2, BTC2A6 and BTC2E1 will be described elsewhere. Strain PD301 was first transfected with plasmid pLCM-b5-RED and subsequently with the different CYP expression vectors resulting in strains BTC-b5-1A2, BTC-b5-2A6 and BTC-b5-2E1. All strains were verified for the correct phenotype for mutagenicity testing, as described previously (23
For heterologous expression, bacteria were grown at 28°C for 15.5 h in TB medium supplemented with peptone (2 g/l), ampicillin (50 µg/ml), kanamycin (15 µg/ml), chloramphenicol (10 µg/ml),
-aminolevulinic acid (0.1 mM, except for strains with CYP1A2), thiamine (1 µg/ml), a mixture of trace elements (0.4 ml/l) (25) and IPTG (0.2 mM). The cultures were analyzed for their RED-, CYP- and b5-expression, CYP activities and subsequently applied as such for the mutagenicity assay.
Analysis of RED, CYP and b5 expression
Preparation of bacterial membranes, determination of protein content, CYP- and RED-expression, ethoxyresorufin-deethylation, methoxyresorufin-demethylation and coumarin-7-hydroxylation activities were performed as described previously (8
,9
). Chlorzoxazone-6-hydroxylation was measured by reverse phase HPLC according to Pearce et al. (26
). The b5 content was determined using reduced versus oxidized different spectra (22
), with the modifications described by Voice et al. (12
), in which the background spectrum of endogenous interfering E.coli factors of the membranes lacking b5 was subtracted from the spectra of b5-containing membranes, previously normalized for their protein content.
Bioactivation assays
The mutagenicity assays were performed using the liquid pre-incubation assay technique, as described previously (25
). Experiments were performed at least in triplicate. Revertant colonies were counted after the usual 48 h incubation at 37°C. Mutagenic activities (in revertants/nmol or revertants/µmol) were determined from the slope of the linear portion of the doseresponse curve.
Western blot analysis
Membrane proteins were separated by 18% sodium SDSPAGE electrophoresis and electrophoretically transferred onto nitrocellulose membranes (Hybond-ECL Amersham Biosciences). Immunoblotting analyses were carried out with the enhanced chemiluminescent ECL western blotting detection kit of Amersham Biosciences, using polyclonal rabbit anti-rat b5 primary antibody (20
).
| Results |
|---|
|
|
|---|
Construction of BTC-b5-CYP tester strains
The new BTC-b5-CYP tester strains are based on the bi-plasmid expression system (8,9) for the co-expression of a specific CYP form (1A2, 2A6 or 2E1) with human b5, bicistronically co-expressed with human RED. To establish a human b5 expression plasmid, the cDNA encoding the human b5 was inserted upstream of the human RED coding sequence in pLCMhOR (Table I). This newly constructed plasmid (pLCM-b5-RED) (Figure 1) and the pCWori-vector containing the cDNA of the three different CYPs were transfected to the mother strain of BTC resulting in strains BTC-b5-1A2, BTC-b5-2A6 and BTC-b5-2E1 (Table I).
Characterization of RED-, CYP- and b5-expression and CYP activities
Membranes from cells derived from cultures as used for the bioactivation assays were analyzed for their b5, CYP and RED contents (Table II), as well as their CYP activities (Table III). Expression levels of both b5 and CYP could be quantified through spectrophotometric techniques (Figures 2 and 3). Cytochrome b5 expression was further confirmed by a western blot analysis (Figure 4). Immunodetectable b5 was present in membranes derived from BTC-b5-CYP strains but not in membranes derived from BTC-CYP strains. Pure b5 used as control was histidine-tagged (four histidine residues) and, consequently, migrated slightly higher in comparison to the b5 detected in the membranes of BTC-b5-CYP strains. The western blot demonstrated several b5-non-specific signals, which can be easily distinguished through a comparison with the signals of the corresponding b5-void strains.
|
|
|
|
|
The three BTC-b5-CYP strains plus the CYP-void strain BTC-b5 demonstrated similar levels of b5, namely 112 (BTC-b5 and BTC-b5-1A2), 126 (BTC-b5-2A6) and 102 (BTC-b5-2E1) pmol/mg protein. RED expression levels were significantly lower in all the b5 expressing strains in comparison to the b5-void strains (Table II). The RED content of membranes derived from strains co-expressing RED and CYP2E1 was
2-fold higher than the RED content present in membranes derived from strains co-expressing RED with CYP1A2 or CYP2A6. With respect to the CYP levels, the expression of CYP1A2 and CYP2E1 decreased and the expression of CYP2A6 increased in the strains co-expressing b5 in comparison with the corresponding b5-void strains (Table II).
To study the effect of b5 on the catalytic rates of CYP1A2, 2A6 and 2E1, we compared the enzymatic activities with the standard chemical probes of membranes derived from the new BTC-b5-CYP strains with those derived from BTC-CYP strains. CYP enzyme activities were determined as ethoxyresorufin deethylase (EROD) and methoxyresorufin demethylase (MROD) for CYP1A2 expressing strains, as coumarin 7-hydroxylase for CYP2A6 expressing strains and chlorzoxazone 6-hydroxylase for CYP2E1 expressing strains (Table III). Strain BTC1A2 presented EROD and MROD activities
3-fold higher in comparison to strain BTC-b5-1A2. Strains BTC1A2 and BTC-b5-1A2 demonstrated a higher MROD activity when compared with the EROD activity. Strains BTC2A6 and BTC-b5-2A6 demonstrated similar coumarin 7-hydroxylase activities and BTC-b5-2E1 presented a chlorzoxazone 6-hydroxylase activity 2-fold higher than strain BTC2E1. No activity was detected in strain BTC0 and BTC-b5 for all enzymatic reactions (Table III).
Bioactivation assays
The role of b5 on the bioactivation activities of CYP1A2, 2A6 and 2E1 was evaluated with several known procarcinogens.
Five different compounds, namely 1AP, 6AC, IQ, NNK and 2AA were tested with strains BTC-b5-1A2 and BTC1A2. The mutagenic activities (in revertants/nmol) ranged from 1.2 for NNK to 7860 for 2AA with strain BTC1A2 and from 1.1 for NNK to 10716 for 2AA with strain BTC-b5-1A2 (Figure 5). The mutagenicity of 2AA was slightly increased (
1.5-fold) in the presence of b5. The carcinogens 1AP, 6AC, IQ and NNK demonstrated similar mutagenicity in the presence or absence of b5.
|
In order to test the effects of b5 on the bioactivation activities of CYP2A6 and CYP2E1, three different N-nitrosamines, namely NNdEA (Figure 6), NNdPA and NNK (Figure 7) were assayed with strains BTC2A6, BTC-b5-2A6, BTC2E1 and BTC-b5-2E1. These compounds showed an increase in mutagenic activity with the strains co-expressing b5 (BTC-b5-2A6 and BTC-b5-2E1) relative to the corresponding b5-null strains, except for NNK with the BTC2E1 and BTC-b5-2E1 strains, which in both cases, did not demonstrate any mutagenicity. The CYP2A6- (Figure 8) and CYP2E1- (Figure 9) dependent bioactivation of NNdEA increased from 447 and 1228 revertants/µmol to 10058 and 3316 revertants/µmol, respectively when co-expressed with b5. The mutagenicity of NNK increased from 290 to 2481 revertants/µmol when CYP2A6 was co-expressed with b5. The stimulatory effect of b5 on CYP2A6 and CYP2E1 was most striking with NNdPA (Figures 8 and 9). The mutagenicity of this procarcinogen was completely dependent on the presence of b5 with both these CYPs with a mutagenic activity of 702 and 726 revertants/µmol for BTC-b5-2A6 and BTC-b5-2E1, respectively.
|
|
|
|
| Discussion |
|---|
|
|
|---|
We reported previously on the development of a bi-plasmid system for the co-expression of human RED with a particular CYP form in the E.coli tester strain MTC (8
This study describes the development of three new bioactivation tester strains, namely BTC-b5-1A2, BTC-b5-2A6 and BTC-b5-2E1, by co-expressing human b5 in the previously established BTC-CYP tester strain. We used these new strains to study the role of b5 on CYP1A2, 2A6 and 2E1 bioactivation activities with a number of mutagenic compounds.
For all strains, the expression of CYP, RED and b5 could be quantified (Figures 2 and 3 and Table II). The level of b5 expression was similar in the new BTC-b5-CYP strains. The co-expression of b5 with CYP did not seem to have an effect on the expression level of b5 since the BTC-b5 strain demonstrated similar b5 content when compared with the b5 content of the three BTC-b5-CYP strains. On the other hand, the expression of b5 did influence the expression levels of RED and CYP. The co-expression of RED with b5 decreased the expression level of RED. This could be the consequence of the insertion of b5 cDNA upstream relative to RED cDNA in pLCM- b5-RED. It is known that positioning has a significant effect on the expression and activity of proteins encoded by multicistronic plasmids, probably due to the attenuation of transcription and/or translation of the cDNA cloned downstream (15
). With respect to CYP expression levels, b5 had different effects. The yield of CYP1A2 and 2E1 were lower and that of CYP2A6 was higher, when compared with the corresponding b5-void strains for reasons not well understood.
To verify the effect of b5 on the catalytic activities of CYP1A2, 2A6 and 2E1, membranes derived from strains with and without b5 co-expression were analyzed with their specific chemical probes. The turnover rates obtained for ethoxyresorufin deethylation and methoxyresorufin demethylation for strain BTC1A2 and for coumarin 7-hydroxylation for strain BTC2A6 were comparable with those obtained previously with MTC strains (9
). The turnover rates for EROD and MROD were higher with membranes derived from strain BTC1A2 than in membranes derived from strain BTC-b5-1A2. Previous reports showed that the catalytic activities of CYP1A2 were not affected by the presence of b5 (13
,14
,17
) but could be influenced by the RED:CYP ratio (14
). Strain BTC1A2 presents a RED:CYP ratio 2-fold higher than strain BTC-b5-1A2 and thus, the differences described in this study with respect to the CYP1A2 catalytic rates could be due to the different RED:CYP ratios and not to the presence of b5. In this case, it seems likely that b5 has little or no effect on the EROD and MROD reactions performed by CYP1A2, corroborating the results obtained before by others (13
,14
,17
).
Although having different RED contents, membranes derived from strains BTC2A6 and BTC-b5-2A6 presented the same turnover in the coumarin-7-hydroxylation assay. Yamazaki et al. (14
) showed that the addition of purified human b5, but not of extra membrane-bound RED to E.coli membranes of bacteria expressing RED and CYP2A6, enhanced both the coumarin-7-hydroxylation and the nicotine C-oxidation rates. However, in their study, the RED:CYP ratios ranged from 2.4 to 4, much higher than the RED:CYP ratios in membranes derived from BTC and BTC-b5-2A6 strains, which are 0.1 and 0.01, respectively. Our results pertaining to coumarin 7-hydroxylation seems to indicate that either this reaction was not affected by the RED:CYP ratio or that b5 compensated the lower RED content of BTC-b5-2A6 membranes. The rate of chlorzoxazone 6-hydroxylation by CYP2E1 was enhanced 2-fold by b5. This enhancing effect of b5 on CYP2E1 activity is corroborated by others with recombinant enzymes not only for chlorzoxazone 6-hydroxylation (13
,14
,17
) but also for aniline p-hydroxylation, N-nitrosodimethylamine-N-demethylation and 7-ethoxycoumarin-O-deethylation (17
).
The role of b5 on the bioactivation activities of CYP1A2, 2A6 and 2E1 was evaluated with several known procarcinogens with the different BTC strains using the mutagenicity assay. The effect of b5 on CYP1A2 bioactivation activity was tested with several promutagens. The mutagenicity of 1AP, 6AC, IQ and NNK was not affected by b5 co-expression. On the other hand, the mutagenicity of 2AA was slightly but significantly increased (
1.5-fold). The enzymatic activities in membranes derived from BTC1A2 and BTC-b5-1A2 strains, probed as EROD and MROD, as well as the enzymatic activities of CYP1A2 in other in vitro assays with recombinant or reconstituted enzymes (14
,17
), seem to indicate the absence of any stimulatory effect of b5 on CYP1A2 activity. However, taking into account the lower RED content presented in strain BTC-b5-1A2 when compared with BTC1A2 along with our mutagenicity test results, b5 might have small stimulatory effects for some substrates as was demonstrated with 2AA in this study.
The stimulatory role of b5 on CYP2A6 and CYP2E1 bioactivation activities was much more pronounced. The mutagenicity of NNdEA increased 23-fold when b5 was co-expressed with CYP2A6 and 3-fold when co-expressed with CYP2E1. The CYP2A6-dependent mutagenicity of NNK increased 9-fold when this CYP was co-expressed with b5. The relevance of b5 on CYP2A6 and CYP2E1 bioactivation activities was best demonstrated with NNdPA. The mutagenicity of this compound could only be detected when either of these two CYP forms was co-expressed with b5. Stimulation of the CYP2E1-mediated activation of NNdEA and NNdPA by b5 was reported earlier by Cooper and Porter (15
) with a S.typhimurium strain co-expressing b5, CYP2E1 and RED, although in this tester bacterium neither CYP2E1 nor b5 expression could be quantified, hampering a physiologically relevant interpretation.
Several recent studies have been reported on the stimulatory role of b5 on specific CYP forms. These include in vitro assays with reconstituted, recombinant enzymes (11
,12
,14
) or studies in whole bacterial cells co-expressing b5 with RED and CYP (12
,15
,16
,19
). However, in these systems, either the RED:CYP and/or b5:CYP ratio(s) were not determined or were higher than those found in human liver microsomes (28![]()
30
). It is known that the turnover of CYPs in human liver microsomes is affected by several factors that are biochemically distinct from the CYP enzyme itself, such as the concentration of the electron transfer proteins RED and/or b5. Moreover, it is recognized that multiple CYPs compete for the accessory proteins RED and b5 in human liver (30
). When using in vitro systems for the study of the role of CYP biotransformation in xenobiotic metabolism, special attention should be given to the relative concentrations of CYPs and the accessory proteins RED and b5. This is necessary for qualifying the physiological relevance of such systems. In the human liver, the relative RED:CYP and b5:CYP contents can be determined, either for each one of the CYP forms or using the total CYP concentration. The latter method was applied as it mimics the in vivo situation where all CYPs compete for RED and for b5. The BTC-b5-CYP system described here contains RED:CYP and b5:CYP ratios which approximate those found in human liver microsomes (Table IV) and thus, these tester strains mimic human liver microsomes almost exactly. Moreover, in studies using relatively high (>1) RED:CYP ratios (vide supra), the stimulatory role of b5 on CYP activities might not be apparent owing to excessive RED content. This high content may mask the role of b5 in electron transfer facilitation, one of its presumed functional mechanisms in the multimolecular CYP-complex.
|
In conclusion, in this work we established three new bioactivation tester strains, for the co-expression of human b5 with CYP1A2, 2A6 or 2E1 and RED with relative expression levels of these human proteins relevant to the in vivo situation. A strong stimulatory effect of b5 on CYP2A6 and 2E1 bioactivation activities could be demonstrated with these new strains, which was less pronounced for CYP1A2. To our knowledge, this is the first report of a stimulatory effect of b5 on CYP2A6 bioactivation activity. The total dependence of NNdPA mutagenicity on b5 through CYP2A6 and CYP2E1-mediated bioactivation in these tester bacteria is demonstrated. Moreover, the importance of b5 in the CYP2A6-mediated mutagenicity of the tobacco mutagen NNK (9-fold increase) is described here. The results demonstrated here characterize BTC-b5 as a strain of interest for studies on the relevance of b5 on the bioactivation of chemicals by cytochrome P450. Currently, this newly developed BTC-b5 strain is being applied for the study of the role of b5 in the bioactivation of other human CYPs, which are of relevance in xenobiotic biotransformation, such as CYP3A4 and others.
| Acknowledgments |
|---|
The critical reading of this manuscript by Professor Bettie Sue Masters is greatly appreciated. The financial support of the Programa Operacional Ciência, Tecnologia e Inovação (POCTI Medida 1.2) for M.K. at the Faculty of Medical Sciences of the Universidade Nova de Lisboa is acknowledged. This work was supported in part by INTAS (grant 03-55-1593) and NKST RB (grant 19-11).
| Notes |
|---|
* To whom correspondence should be addressed. Tel: +351 21 3610297; Fax: +351 21 3622018; Email: mkranendonk.gene{at}fcm.unl.pt
| References |
|---|
|
|
|---|
-
1. Henderson,C.J., Otto,D.M.E., Carrie,D., Magnuson,M.A., McLaren,A.W., Rosewell,A.W. and Wolf,C.R. (2003) Inactivation of the hepatic cytochrome P450 system by conditional deletion of hepatic cytochrome P450 reductase. J. Bio. Chem., 278, 1348013486.
2. Ingelman-Sundberg,M. (2004) Human drug metabolising cytochrome P450 enzymes: properties and polymorphisms. Nanuyn-Schmiedebergs Arch. Pharmacol., 369, 89104.
3. Ingelman-Sundberg,M. (2001) Genetic susceptibility to adverse effects of drugs and environmental toxicants. The role of the CYP family of enzymes. Mutat. Res., 482, 1119.[Web of Science][Medline]
4. Autrup,H. (2000) Genetic polymorphisms in human xenobiotica metabolizing enzymes as susceptibility factors in toxic response. Mutat. Res., 464, 6576.[Web of Science][Medline]
5. Guengerich,F.P. (1998) The environmental genome project: functional analysis of polymorphisms. Environ. Health Perspect., 106, 365368.[Web of Science][Medline]
6. Kranendonk,M., Laires,A., Rueff,J., Estabrook,R.W. and Vermeulen,N.P.E. (2000) Heterologous expression of xenobiotic mammalian-metabolizing enzymes in mutagenicity tester bacteria: an update and practical considerations. CRC Crit. Rev. Toxicol., 30, 287306.
7. Rueff,J., Gaspar,J. and Kranendonk,M. (2002) DNA polymorphisms as modulators of genotoxicity and cancer. Biol. Chem., 383, 923932.[CrossRef][Web of Science][Medline]
8. Kranendonk,M., Fisher,C.W., Roda,R., Carreira,F., Theisen,P., Laires,A., Rueff,J., Vermeulen,N.P.E. and Estabrook,R.W. (1999) Escherichia coli MTC, a NADPH cytochrome P450 reductase competent mutagenicity tester strain for the expression of human cytochrome P450: comparison of three types of expression systems. Mutat. Res., 439, 287300[Web of Science][Medline]
9. Kranendonk,M., Roda,R., Carreira,F., Theisen,P., Laires,A., Fisher,C.W., Rueff,J., Vermeulen,N.P.E. and Estabrook,R.W. (1999). Escherichia coli MTC, a human NADPH cytochrome P450 reductase competent mutagenicity tester strain for the expression of human cytochrome P450 isoforms 1A1, 1A2, 2A6, 3A4 or 3A5: catalytic activities and mutagenicity studies. Mutat. Res., 441, 7383.[Web of Science][Medline]
10. Schenkan,J.B. and Jansson,I. (2003) The many roles of cytochrome b5. Pharmacol. Ther., 97, 139152.[CrossRef][Web of Science][Medline]
11. Yamaori,S., Yamazaki,H., Suzuki,A., Yamada,A., Tani,H., Kamidate,T., Fujita,K. and Kamataki,T. (2003) Effects of cytochrome b5 on drug oxidation activities of human cytochrome P450 (CYP) 3As: similarity of CYP3A5 with CYP3A4 but not CYP3A7. Biochem. Pharmacol., 66, 23332340.[CrossRef][Web of Science][Medline]
12. Voice,M.W., Zhang,Y., Wolf,R., Burchel,B. and Friedberg,T. (1999) Effects of human cytochrome b5 on CYP3A4 activity and stability in vivo. Arch. Biochem. Biophys., 366, 116124.[CrossRef][Web of Science][Medline]
13. Yamazaki,H., Gillam,E.M.J., Dong,M.S., Johnson,W.W., Guengerich,F.P. and Shimada,T. (1997) Reconstitution of recombinant cytochrome P450 2C10(2C9) and comparison with cytochrome 3A4 and other forms: Effect of cytochrome P450-P450 and cytochrome P450-b5 interactions. Arch. Biochem. Biophys., 342, 329337.[CrossRef][Web of Science][Medline]
14. Yamazaki,H., Nakamura,M., Komatsu,T., Ohyama,K., Hatanaka,N., Asahi,S., Shimada,N., Guengerich,F.P., Shimada,T., Nakajima,M. and Yokoi,T. (2002) Roles of NADPH-P450 reductase and apo- and holo-cytochrome b5 on xenobiotic oxidations catalysed by 12 recombinant human cytochrome P450s expressed in membranes of Escherichi coli. Protein Expr. Purif., 24, 329337.[CrossRef][Web of Science][Medline]
15. Cooper,M.T. and Porter,T.D. (2001) Cytochrome b5 coexpression increases the CYP2E1-dependent mutagenicity of dialkylnitrosamines in methyltransferase-deficient strains of Salmonella typhimurium. Mutat. Res., 484, 6168.[Web of Science][Medline]
16. Mokashi,V., Li,L. and Porter,T.D. (2003) Cytochrome b5 reductase and cytochrome b5 support the CYP2E1-mediated activation of nitrosamines in a recombinant Ames test. Mutat. Res., 412, 147152.
17. Yamazaki,H., Nakano,M., Gillam,E.M.J., Bell,L.C., Guengerich,F.P. and Shimada,T. (1996) Requirement for cytochrome b5 in the oxidation of 7-ethoxycoumarin, chlorzoxazone, aniline, and N-nitrosodimethylamine by recombinant cytochrome P450 2E1 and by human liver microsomes. Biochem. Pharmacol., 52, 301309.[CrossRef][Web of Science][Medline]
18. Loughran,P.A., Roman,L.J., Miller,R.T. and Masters,B.S.S. (2001) The kinetic and spectral characterization of the E.coli expressed mammalian CYP4A7: cytochrome b5 effects vary with substrate. Arch. Biochem. Biophys., 385, 311321.[CrossRef][Web of Science][Medline]
19. Kang,I.H., Kim,H.J., Oh,H., Park,Y.I. and Dong,M.S. (2004). Biphasic effects of the flavonoids quercetin and naringenin on the metabolic activation of 2-amino-3,5-dimethylimidazo[4,5-f]quinoline by Salmonella typhimurium TA1538 co-expressing human cytochrome P450 1A2, NADPH-cytochrome P450 reductase, and cytochrome b5. Mutat. Res., 545, 3747.[Web of Science][Medline]
20. Gilep,A.A., Guryev,O.L., Usanov,S.A. and Estabrook,R.W. (2001) Expression, purification, and physical properties of recombinant flavocytochrome fusion proteins containing rat cytochrome b5 linked to the NADPHcytochrome P450 reductase by different membrane-binding segments. Arch. Biochem. Biophys., 2, 222234.
21. Yamazaki,H., Shimada,T., Martin,M.V. and Guengerich,F.P. (2001) Stimulation of cytochrome P450 reactions by apo-cytochrome b5. J. Biol. Chem., 276, 3088530891
22. Holmans,P.L., Shet,M.S., Martin-Wixtrom,C.A., Fisher,C.W. and Estabrook,R.W. (1994) The high-level expression in Escherichia coli of the membrane-bound form of rat cytochrome b5 and studies on their mechanism of function. Arch. Biochem. Biophys., 2, 554565.
23. Kranendonk,M., Pintado,F., Mesquita,P., Laires,A., Vermeulen,N.P.E. and Rueff,J. (1996) MX100, a new Escherichia coli tester strain for use in genotoxicity studies. Mutagenesis, 11, 327333.
24. Sambrook,J., Fritsch,T.F. and Maniatis,T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
25. Kranendonk,.M, Mesquita,P., Laires,A., Vermeulen,N.P.E. and Rueff,J. (1998) Expression of human cytochrome P450 1A2 in Escherichia coli: a system for biotransformation and genotoxicity studies of chemical carcinogens. Mutagenesis, 13, 263269.
26. Pearce,R.R., McIntyre,C.J., Madan,A., Sanzgiri,U., Draper,A.J., Bullock,P.L., Cook,D.C., Burton,A., Latham,J., Nevins,C. and Parkinson,A. (1996) Effects of freezing, thawing and storing human liver microsomes on cytochrome P450 activity. Arch. Biochem. Biophys., 2, 145169.
27. Kranendonk,M., Commandeur,J.N., Laires,A., Rueff,J. and Vermeulen,N.P.E. (1997) Characterization of enzyme activities and cofactors involved in bioactivation and bioinactivation of chemical carcinogens in the tester strains Escherichia coli K12 MX100 and Salmonella typhimurium LT2 TA100. Mutagenesis, 12, 245254.
28. Paine,M.F., Khalighi,M., Fisher,J.M., Shen,D.D., Kunze,K.L., Marsh,C.L., Perkins,J.D. and Thummel,K.E. (1997) Characterization of interintestinal and intraintestinal variations in human CYP3A4-dependent metabolism. J. Pharmacol. Exp. Ther., 283, 15521562.
29. Yamazaki,H., Nakajima,M., Nakamura,M., Asahi,S., Shimada,N., Gillam,E.M.J., Guengerich,F.P., Shimada,T. and Yokoi,T. (1999) Enhancement of cytochrome P-450 3A4 catalytic activities by cytochrome b5 in bacterial membranes. Drug Metab. Dispos., 27, 9991004.
30. Venkatakrishnan,K., Von Moltke,L.L., Court,J.S., Harmatz,J.S., Crespi,C.L. and Greenblatt,D.J. (2000) Comparison between cytochrome P450 (CYP) content and relative activity approaches to scaling from cDNA-expressed CYPs to human liver microsomes: ratios of accessory proteins as sources of discrepancies between approaches. Drug Metab. Dispos., 28, 14931504.
31. Fisher,C.W., Caudle,D.L., Martin-Wixtrom,C., Quattrochi,L.C., Tukey,R.H., Waterman,M.R. and Estabrook,R.W. (1992) High-level expression of functional human cytochrome P450 1A2 in Escherichia coli. FASEB J., 6, 759764.
Received on January 4, 2005; revised on January 24, 2005; accepted on January 25, 2005.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. C. Marohnic, S. P. Panda, K. McCammon, J. Rueff, B. S. S. Masters, and M. Kranendonk Human Cytochrome P450 Oxidoreductase Deficiency Caused by the Y181D Mutation: Molecular Consequences and Rescue of Defect Drug Metab. Dispos., February 1, 2010; 38(2): 332 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Duarte, B. B. Palma, A. A. Gilep, A. Laires, J. S. Oliveira, S. A. Usanov, J. Rueff, and M. Kranendonk The stimulatory role of human cytochrome b5 in the bioactivation activities of human CYP1A2, 2A6 and 2E1: a new cell expression system to study cytochrome P450-mediated biotransformation (a corrigendum report on Duarte et al. (2005) Mutagenesis 20, 93-100) Mutagenesis, January 1, 2007; 22(1): 75 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Duarte, B. B. Palma, A. Laires, J. S. Oliveira, J. Rueff, and M. Kranendonk Escherichia coli BTC, a human cytochrome P450 competent tester strain with a high sensitivity towards alkylating agents: involvement of alkyltransferases in the repair of DNA damage induced by aromatic amines Mutagenesis, May 1, 2005; 20(3): 199 - 208. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










