Skip Navigation

Mutagenesis 2006 21(4):243-247; doi:10.1093/mutage/gel022
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Shaposhnikov, S.
Right arrow Articles by Nilsson, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shaposhnikov, S.
Right arrow Articles by Nilsson, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Author 2006. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please email: journals.permissions@oxfordjournals.org

Detection of Alu sequences and mtDNA in comets using padlock probes

Sergey Shaposhnikov1, Chatarina Larsson2, Sara Henriksson2, Andrew Collins1,* and Mats Nilsson2

1 Institute of Basic Medical Sciences, University of Oslo PB 1046 Blindern, 0316 Oslo, Norway 2 Department of Genetics and Pathology, Rudbeck Laboratory, Uppsala University Se-75185 Uppsala, Sweden

Single cell gel electrophoresis, or the comet assay, is widely used to measure DNA damage and repair. However, the behaviour of the DNA under the conditions used for the comet assay is not fully understood. In developing a method for studying specific gene sequences within comets, using ‘padlock probes’ (circularizable oligonucleotide probes), we have first applied probes that hybridize to Alu repetitive elements and to mitochondrial DNA (mtDNA). During the sequence of stages in the comet assay, mtDNA progressively disperses into the surrounding agarose gel, showing no tendency to remain with nuclear DNA in the comets. In contrast, Alu probes remain associated with both tail and head DNA.


    Introduction
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 Conclusion
 References
 
The comet assay is a sensitive method for measuring DNA damage and repair in individual cells, applied widely in a variety of research areas, including use as a biomarker assay in human population studies, testing for genotoxicity of novel compounds, and investigating basic molecular mechanisms of DNA damage and repair in cultured cells (1Go). It involves electrophoresis of nucleoids in agarose gels on a microscope slide, resulting in images resembling comets, in which the tail represents DNA which has been broken, and intact DNA remains in the head. The explanation most consistent with observations is based on the model of DNA as a series of supercoiled loops attached to the nuclear matrix. DNA loops in which supercoiling has been relaxed by a break are free to extend under electrophoresis towards the anode, forming the comet tail. The DNA content of the comet tail relative to the head, estimated from fluorescence intensity after staining with a DNA-binding dye, reflects the frequency of DNA breaks.

Several reports have appeared in which specific genes are identified, and repair of DNA damage has been shown to proceed at different rates in different genes (1Go–3Go). An incidental but exciting observation is that the location of certain genes within the comet appears to be determined by their association with the matrix in the intact cell, indicating that the structural organization of the chromatin survives cell lysis and electrophoresis to a significant extent (2Go). Thus it should be possible to localize DNA sequences within the residual nuclear structure of the comet.

Conventional FISH is not without problems when applied to comets. Comets are fragile, and not strongly attached to the glass on which the gel is set. Agarose gels can melt or detach under the standard stringent FISH conditions required for single copy genomic probes. High background fluorescence, linked with the necessity of amplifying the signals with fluorescent antibodies, is a further technical obstacle.

Here we report a novel FISH-comet approach that resolves these difficulties by using padlock probe technology, a powerful tool for highly specific DNA sequence recognition (4Go). Padlock probes are linear oligonucleotides designed so that the two end segments, connected by a linker region, are complementary to adjacent target sequences so that upon hybridization, the two probe ends become juxtaposed and can be joined by a DNA ligase. This circularizes the padlock probe and renders it catenated to the target sequence. The reaction is highly specific, requiring a perfect match between the probe end sequences and the target sequence. By amplifying circularized padlock probes through target-primed rolling-circle amplification (RCA) in situ, specifically reacted probes are copied hundreds of times in a long single-stranded extension of the target strand. The RCA products are then detected by hybridization with fluorescently labelled complementary DNA molecules (5Go). Thus the amplified padlock probes are readily distinguishable from nonspecifically bound probe molecules and other detection reagents—a substantial advantage in comparison with standard hybridization probes (Figure 1). Performing all reaction steps at low temperature (37°C) reduces the risk of loss of DNA through melting of the gel. The complexity of the padlock probes is orders of magnitude less than that of the extended genomic clones normally used for standard FISH, which increases the specificity of the hybridization. The use of oligonucleotides gives padlock technology yet another potential advantage, as short DNA probes are expected to penetrate agarose rapidly, allowing fast delivery of the probe to the target sequence combined with thorough elimination of unbound probe molecules during the washing steps. As a preliminary to resolving specific nuclear gene sequences within the comet, we have used padlock probes to identify mitochondrial DNA (mtDNA) and the 26 bp core sequence of the Alu repetitive element in comet preparations. The results show that after the comet assay, mtDNA tends to disperse into the surrounding gel, showing no association with DNA of the comets. In contrast, Alu repeats show both tail and head location in comets.


Figure 1
View larger version (81K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Target-primed RCA of padlock probes in situ. (A) Overview of procedure. The target DNA is made single stranded and available for hybridization using specific restriction digestion and 5' exonucleolysis. Target-matched padlock probes are circularized by sequence-specific ligation, and reacted probes are amplified using RCA. (B) The RCA products are visualized by hybridization of fluorescence-labelled oligonucleotides and form sub-micron sized objects that can be observed using fluorescence microscopy.

 

    Materials and methods
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 Conclusion
 References
 
Cells
Transformed human epithelial cells (HeLa) were used to produce preparations of DNA representing different stages of the comet assay. Human osteosarcoma cells (143B) were used as positive controls for in situ detection of padlock probes, and also to investigate the kinetics of dispersal of mtDNA during cell lysis, as they have previously been used for mitochondrial genotyping using this method (5Go).

HeLa cells were cultured in dishes in Dulbecco's Modified Eagles medium (Gibco) supplemented with 7% fetal calf serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cells were detached by trypsinization, counted, aliquoted into Eppendorf tubes and centrifuged at 200x g, 3 min. The pellets were suspended in 85 µl of low melting-point agarose at 37°C to form the gels. The density of cells in each gel was calculated so that each gel contained ~104 cells.

143B cells were cultured in Dulbecco's Modified Eagle's medium without phenol red, with 10% fetal bovine serum, 50 µg/ml uridine, 0.1% glucose, 292 µg/ml L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cells were grown on glass microscope slides. In some cases, a drop of 1% agarose in PBS was placed on the cells, covered with a coverslip and left to set at 4°C. Other cells (from culture in dishes) were mixed with 1% agarose in PBS and placed on a microscope slide (precoated with agarose), covered with a coverslip and left to set at 4°C. Some of these cell preparations then underwent lysis (to simulate comet assay conditions) for different times. Non-lysed agarose-coated and agarose-embedded cells, as well as cells without agarose, were used as positive controls for padlock probe detection.

All preparations of cells were fixed in 70% ethanol for 20 min at room temperature and stored in fresh 70% ethanol at 4°C until padlock probe detection.

The comet assay; single cell gel electrophoresis
Plain glass microscope slides were precoated by dipping in a solution of 1% normal electrophoresis grade agarose (Gibco-BRL) in distilled water and drying. Cells in 85 µl of agarose at 37°C were placed on a precoated slide and covered with a glass coverslip. Gels were left to set at 4°C and then, after removing coverslips, either placed in lysis solution (2.5 M NaCl, 0.1 M Na2EDTA, 10 mM Tris made to pH 10.0 with NaOH, plus 1% Triton X-100) for 1 h at 4°C, or first treated with H2O2 as described below and then placed in lysis solution. For the alkaline comet assay, slides were then placed in an electrophoresis tank, and immersed in 0.3 M NaOH, 1 mM Na2EDTA for 40 min, before electrophoresis at 25 V (0.8 V/cm) for 30 min at an ambient temperature of 4°C. After electrophoresis, slides were neutralized by washing 3 times for 5 min with 0.4 M Tris–HCl, pH 7.5. For the neutral comet assay, after lysis, slides were washed with 1x TBE buffer (0.09 M Tris-borate, 0.002 M EDTA, pH 7.5.), placed in the electrophoresis tank containing 1x TBE, and electrophoresed at 25 V for 30 min at 4°C.

For padlock detection, the slides after each step of the comet assay (including different times of lysis) were fixed in 70% ethanol for 20 min at room temperature, and then stored in fresh 70% ethanol at 4°C until use.

Treatment with H2O2
Cells embedded in agarose on microscope slides were placed in staining jars containing 0.1 mM H2O2 in PBS at 4°C for 5 min. The slides were then washed twice in PBS at 4°C and transferred into lysis solution for subsequent use in the comet assay and/or for padlock detection.

Treatment of samples for in situ detection
Slides prepared as above were treated with 0.01% pepsin (Sigma) in 0.1 M HCl for 90 s at 37°C in a staining jar, followed by brief washes in PBS and dehydration in a series of 70, 85 and 100% ethanol. Subsequent incubations in the DNA detection procedure were carried out as detailed in the following sections, in a volume of 20 µl under 22 x 22 mm coverslips, except for the RCA reaction which was carried out in a larger volume in PAPpen(Dako) encircled areas.

Enzymatic target preparation
After pepsin treatment the target sequences were rendered accessible for hybridization by digestion with a combination of restriction and exonuclease enzymes (5Go). To prepare slides for mtDNA detection, the DNA on the slides was digested using 0.5 U/µl of MscI (New England Biolabs) and 0.4 U/µl of T7 exonuclease (New England Biolabs) at 37°C for 45 min in 1x NEB4 buffer supplemented with 0.2 µg/µl BSA (New England Biolabs). The slides were then rinsed in wash buffer (0.1 M Tris–HCl pH 7.5, 0.15 M NaCl and 0.05% Tween-20).

To prepare slides for Alu detection, the DNA on the slides was first restriction digested using 0.5 U/µl of AluI (New England Biolabs) at 37°C for 45 min in 1 x NEB4 buffer supplemented with 0.2 µg/µl BSA. The slides were then rinsed in wash buffer. The ends of the AluI restriction fragments were then made single stranded by exonucleolysis using 0.2 U/µl {lambda} exonuclease (New England Biolabs) at 37°C for 45 min in the buffer supplied, supplemented with 0.2 µg/µl BSA and 10% glycerol. The slides were then rinsed in wash buffer.

Padlock probe hybridization and ligation
MtDNA and Alu-specific padlock probes were purchased from DNA Technology A/S (Denmark). The sequences were as follows: MtDNA probe, ppMSCs, 5'-P-TAAGAAGAGGAATTGCCTTTCCTACGACCTCAATGCACATGTTTGGCTCCTCTTCCCATGGGTATGTTGT; Alu probe, ppAlu, 5'-P-CTGGGATTACAGGCCTTTCCTACGACCTCAATGCACATGTTTGGCTCCTCTTCGCCTCCCAAAGTG-3'. Target complementary sequences of padlock probes are given in italics, and tag-sequence segments of padlock probes used for fluorescent detection are underlined. Padlock probe hybridization and ligation were performed in a single reaction containing either mtDNA specific padlock probe or Alu padlock probe at a concentration of 100 nM per probe, and 0.1 U/µl T4 DNA ligase (Fermentas) in 10 mM Tris–Ac pH 7.5, 10 mM MgAc2, 1 mM ATP, 0.2 µg/µl BSA and 250 mM NaCl at 37°C for 1 h. The slides were then washed in a buffer containing 2xSSC, 0.05% Tween-20 for 5 min at 37°C, rinsed once in wash buffer and dehydrated in a series of 70, 85 and 100% ethanol.

Rolling-circle amplification
The RCA reactions were performed on dehydrated slides in 50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 20 mM (NH4)2SO4, 0.2 µg/µl BSA, 1 mM DTT, 0.25 mM dNTP, 10% glycerol and 1 U/µl {Phi}29 DNA polymerase (Fermentas) at 37°C for 2 hours. After polymerization, the slides were washed in wash buffer. The single-stranded RCA product was detected by hybridizing 250 nM of Lin33 fluorescent-labelled oligonucleotide probe in a solution of 2 x SSC and 20% formamide for 30 min at 37°C. After a brief rinse in wash buffer the slides were finally dehydrated and mounted with Vectashield (Vector Laboratories) containing 10 ng/ml DAPI for microscopy. The Lin33 fluorescence-labelled probe (5'-FITC-CCTCAATGCACATGTTTGGCTCC-3') was purchased from Thermo Hybaid (Germany).

Image analysis
Images were acquired using an epifluorescence microscope (Axioplan II, Zeiss), equipped with a 100 W mercury lamp, a CDD camera (C472-95, Hamamatsu) and a computer-controlled filter wheel with excitation and emission filters for visualization of DAPI, FITC and Cy3. The images were collected and analysed using the AxioVision 4.3 software (Zeiss).


    Results
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 Conclusion
 References
 
Detection of mtDNA in comets
To identify mtDNA within alkaline comet preparations, we used a padlock probe specific for a sequence in the mitochondrial genome. This padlock probe was previously tested for detection of specific mitochondrial sequence by target-primed RCA with subsequent fluorescent hybridization detection (5Go), giving strong discrete signals of green. Therefore, this padlock probe was chosen as a convenient, reliable and proven tool for detection of mtDNA in comets.

To monitor the behaviour of mtDNA within comet preparations throughout the comet assay procedure, in situ hybridization and detection of the probe were performed on preparations of DNA on microscope slides in low melting-point agarose, representing all main steps in the comet assay. We used HeLa cells to make DNA preparations from the following stages: (1Go) fresh cells in agarose, (2Go) cells in agarose treated with the lysis solution, (3Go) cells in agarose treated with the lysis solution and incubated in alkaline electrophoresis solution, (4Go) cells electrophoresed after treatment with lysis and alkaline solutions. Duplicate slides were treated with H2O2 after embedding and before lysis. To control the specificity of the reaction, in each set of experiments we included a negative control containing no ligase, and positive controls consisting of 143B cells grown and fixed on glass slides with and without agarose, or embedded in agarose and placed and fixed on slides. As expected, there were no signals detected in the negative controls, whereas there were clearly distinguishable strong signals in the positive controls.

Our results show that during the comet assay mitochondrial signals tend to disperse into the surrounding gel, finally showing no association with DNA of the comets. Thus, fresh cells embedded in agarose and fixed with ethanol produced strong signals located around and within the residual cell or cell nucleus. After 1 h incubation in lysis solution, fewer signals were detected and the signals become more spread, showing diminished association with the DAPI-stained genomic DNA. The signals were even more dispersed after alkaline incubation, and totally lost their association with nuclear DNA after alkaline electrophoresis. H2O2-treatment did not affect the distribution pattern of the signals. Typical images are shown in Figure 2 I. Interestingly, the most significant change of the distribution of the signals was observed between stages (1Go) and (2Go) of the comet assay, i.e. between embedding in agarose and lysis. Hence it is clear that diffusion of the mtDNA into the gel and loss of association with the remains of the cell begins very early in the comet assay procedure.


Figure 2
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. In situ detection of individual DNA molecules within preparations of human nuclei from different stages of the comet assay by target-primed RCA of padlock probes. DAPI-stained nuclear DNA is shown in blue and RCA products are shown in green. Bars represent 20 µm. All images were captured using 63x magnification, except for image III (A), which was acquired using 20x magnification. (I) Detection of mtDNA within preparations of HeLa cell nuclei representing different steps of the comet assay: (A) fresh cells in agarose; (B) cells in agarose treated with H2O2 and lysis solution; (C) cells electrophoresed after treatment with lysis and alkaline solutions. (II) Detection of mtDNA within preparations of 143B cells embedded in agarose: (A) fresh cells; (B) cells treated with lysis solution for 150 s; (C) cells treated with lysis solution for 20 min. (III) Detection of Alu repeats within preparations of HeLa cell nuclei: (A) cells in agarose treated with lysis solution; (B) electrophoresed under alkaline conditions cells after treatment with H2O2, lysis and alkaline solutions; (C) electrophoresed under neutral conditions after treatment with H2O2 and lysis solution.

 
To follow the dynamic of diffusion of the mtDNA into the gels during the lysis step, the detection experiments were also performed on cells embedded in agarose and treated with lysis solution for 0, 2.5, 7, 20 and 60 min. To make these preparations, we used 143B cells embedded in low melting-point agarose. Representative images illustrating the detection of mitochondrial signals within these preparations are shown in Figure 2 II. Slight diffusion of the signals into the gels occurred already after 2.5 min of incubation in the lysis solution, becoming more significant after 7 min and reaching the highest degree after 1 h. To summarize, these results show that during the comet assay procedure mtDNA tends to disperse into the surrounding gel, eventually showing no association with DNA of the comets.

Detection of Alu repeats in comets
The distribution of Alu repetitive sequences was investigated in both alkaline and neutral comets from H2O2-treated HeLa cells. The ppAlu padlock probe targeting the 26 bp core sequence of the Alu repetitive element (6Go) was detected through target-primed RCA as described in Materials and methods. To control the detection reaction we used 143B cells as well as HeLa cells embedded in agarose. The specificity of the reactions was also ensured by including in each set of experiments a negative control containing no ligase.

The in situ detection resulted in strong Alu-specific signals located in both tails and heads of the comets (Figure 2 III). (The comets resulted from H2O2-treatment, which induces single-strand breaks and relaxes supercoiling. Under either neutral or alkaline electrophoresis conditions, tails are formed.)

No signals were observed in the negative controls containing no ligase, confirming the specificity of the reaction. The density of Alu signals observed within comets is consistent with the high number of Alu repeats in the human genome, estimated at around one million per cell (7Go).


    Discussion
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 Conclusion
 References
 
Although the comet assay in its various versions is in use in many different laboratories, its underlying principles, potential scope and limitations are still not completely clear. A question that is often raised relates to the behaviour of mtDNA under the conditions of lysis and electrophoresis used in the comet assay. If the broken, alkali-denatured genomic DNA is migrating as fragments, then the mtDNA molecules should move with the fragments, at a rate according to their size. Could the mtDNA even serve as an internal calibration standard, allowing quantitation of the levels of breakage detected in the comet assay? To date, the only means of calibrating the assay is to treat cells with ionizing radiation, and to rely on the published data for the yield of DNA breaks—around 0.3 single-strand breaks per 109 daltons per Gy (8Go).

However, before proceeding further along this path of reasoning, it is worth examining the evidence concerning the length of pieces of DNA detected in the comet assay. At a dose of ionizing radiation of 10 Gy, almost all the DNA appears in the tail and the assay is insensitive to further increases in dose (9Go). Thus the maximum level of damage that can be detected is about 3 breaks per 109 daltons. This corresponds to an average length of DNA between breaks of 106 bases (or around 250 µm in extended length). MtDNA, with a size of 16 569 bp, is 60 times smaller than the average genomic DNA fragment, and is circular rather than linear; the electrophoretic behaviour of molecules so different in size and nature cannot be directly compared, but the mtDNA would be expected to travel at a higher rate. Another consideration is that mtDNA resides in the cytoplasm, and so a close association with nuclear DNA, even at the start of the comet assay procedure, might not be expected. To demonstrate convincingly the role that mtDNA plays—or does not play—within comets, we have studied the distribution of mtDNA within comet preparations using FISH with padlock probes specific for a sequence of the mitochondrial genome, using target-primed RCA for detection of the correctly hybridized probe. Only at the very start of the lysis stage is mtDNA located close to the nuclear DNA; dispersion into the surrounding gel starts immediately, and by the end of the lysis step there is no association between nuclear and mtDNA. The question whether damage to mtDNA can be detected with the comet assay clearly does not arise.

These observations are consistent with the model for the formation of comet tails that proposes that the tail derives from loops of DNA attached to the nuclear skeleton in which the supercoiling is relaxed by strand breaks (10Go). MtDNA molecules, in contrast, are comparatively small, have no attachment sites for the nuclear matrix, and, therefore, migrate freely.

The question then arises, why, under standard electrophoresis conditions, does DNA of the size of mtDNA stay within a discrete band, rather than diffusing through the gel? It is important to remember the scale of the migration seen here. The dimensions of the comet are measured in microns; a typical tail length is about 60 µm. This is small compared with the width of a conventional electrophoresis band. It is a commonplace observation that bands become broader if the gel is left for some time—consistent with the dispersal we see.

Alu repeats are widely distributed throughout the genome, and are responsible for several genetic effects, including insertion mutations, recombination between elements, gene conversion and alterations in gene expression (11Go). Alu sequences are the most abundant family of repeats in the human genome comprising as much as 10% of the genome (7Go). It was, therefore, of interest to study the distribution of Alu sequences within comets. As expected, we observed a high number of Alu-specific signals within the comets.

In contrast to mtDNA, the Alu repeat detected with specific ppAlu padlock probe was located in both tail and head regions of comets and did not show any sign of dispersal.


    Conclusion
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 Conclusion
 References
 
Our novel approach for detection of individual DNA sequences within comet preparations was successfully used to investigate the distribution of mtDNA and Alu repeats, and to clarify the issue of how mtDNA behaves in the comet assay. In comparison with previously published FISH-comet techniques, our approach has some distinct advantages, such as speed, specificity and the use of gentle, low-stringency conditions which helps to preserve the comet DNA in the gel. It is potentially of value in various situations where it is necessary to identify specific DNA sequences.

Conflict of interest statement: Mats Nilsson has licensed the commercial rights to the technology to Olink AB (Uppsala, Sweden), a company in which M. N. also holds stock.


    Notes
 
*To whom correspondence should be addressed: Department of Nutrition, University of Oslo, POB 1046 Blindern, 0316 Oslo, Norway; Tel: +47 22 85 13 60; Fax: +47 22 85 13 41; E-mail: andrew.collins{at}medisin.uio.no


    References
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 Conclusion
 References
 

    1. Collins A.R. (2004) The comet assay for DNA damage and repair: principles, applications, and limitations. Mol. Biotechnol. 26:249–261.[CrossRef][Web of Science][Medline]

    2. Horvathova E., Dusinska M., Shaposhnikov S., Collins A.R. (2004) DNA damage and repair measured in different genomic regions using the comet assay with fluorescent in situ hybridization. Mutagenesis 19:269–276.[Abstract/Free Full Text]

    3. McKenna D.J., Rajab N.F., McKeown S.R., McKerr G., McKelvey-Martin V.J. (2003) Use of the comet-FISH assay to demonstrate repair of the TP53 gene region in two human bladder carcinoma cell lines. Radiat. Res. 159:49–56.[CrossRef][Web of Science][Medline]

    4. Nilsson M., Dahl F., Larsson C., Gullberg M., Stenberg J. (2006) Analyzing genes using closing and replicating circles. Trends Biotechnol. 24:83–88.[CrossRef][Web of Science][Medline]

    5. Larsson C., Koch J., Nygren A., Janssen G., Raap A.K., Landegren U., Nilsson M. (2004) In situ genotyping individual DNA molecules by target-primed rolling-circle amplification of padlock probes. Nat. Methods 1:227–232.[CrossRef][Web of Science][Medline]

    6. Rudiger N.S., Gregersen N., Kielland-Brandt M.C. (1995) One short well conserved region of Alu-sequences is involved in human gene rearrangements and has homology with prokaryotic chi. Nucleic Acids Res. 23:256–260.[Abstract/Free Full Text]

    7. Price A.L., Eskin E., Pevzner P.A. (2004) Whole-genome analysis of Alu repeat elements reveals complex evolutionary history. Genome Res. 14:2245–2252.[Abstract/Free Full Text]

    8. Ahnström G. and Erixon K. (1981) Measurement of strand breaks by alkaline denaturation and hydroxyapatite chromatography. In Friedberg E.C. and Hanawalt P.C. (Eds.). A Laboratory Manual of Research Procedures (1B Marcel Dekker, New York) pp. 403–418.

    9. Collins A.R., Dusinska M., Gedik C.M., Stetina R. (1996) Oxidative damage to DNA: do we have a reliable biomarker? Environ. Health Perspect. 104:Suppl. 3, 465–469.

    10. Östling O. and Johanson K.J. (1984) Microelectrophoretic study of radiation-induced DNA damages in individual mammalian cells. Biochem. Biophys. Res. Commun. 123:291–298.[CrossRef][Web of Science][Medline]

    11. Batzer M.A. and Deininger P.L. (2002) Alu repeats and human genomic diversity. Nat. Rev. Genet. 3:370–379.[CrossRef][Web of Science][Medline]

Received on March 6, 2006; revised on April 10, 2006; accepted on April 10, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
MutagenesisHome page
S. Shaposhnikov, E. Frengen, and A. R. Collins
Increasing the resolution of the comet assay using fluorescent in situ hybridization--a review
Mutagenesis, September 1, 2009; 24(5): 383 - 389.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
A. R. Collins, A. A. Oscoz, G. Brunborg, I. Gaivao, L. Giovannelli, M. Kruszewski, C. C. Smith, and R. Stetina
The comet assay: topical issues
Mutagenesis, May 1, 2008; 23(3): 143 - 151.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Shaposhnikov, S.
Right arrow Articles by Nilsson, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shaposhnikov, S.
Right arrow Articles by Nilsson, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?