Mutagenesis Advance Access originally published online on September 29, 2006
Mutagenesis 2006 21(6):391-397; doi:10.1093/mutage/gel041
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press 2006
ACB-PCR measurement of K-ras codon 12 mutant fractions in livers of Big Blue® rats treated with N-hydroxy-2-acetylaminofluorene
1 Division of Genetic and Reproductive Toxicology HFT-120 3900 NCTR Road, Jefferson, AR 72079, USA 2 Division of Biometry and Risk Assessment, National Center for Toxicological Research 3900 NCTR Road, Jefferson, AR 72079, USA
K-ras codon 12 GGT
GAT and GGTGTT mutations are the most frequently observed K-ras point mutations in human and rodent tumors and therefore are implicated in carcinogenesis for many tissues. Measurement of these mutations in rat models and human tissue could facilitate a more logical extrapolation of rodent tumorigenesis data to human disease. We have developed allele-specific competitive blocker PCR (ACB-PCR) assays for rat K-ras codon 12 GGTGTT and GGTGAT mutations that parallel the already published assays for human K-ras codon 12 mutations. Liver K-ras codon 12 mutant allele fractions were measured in vehicle-treated and N-hydroxy-2-acetylaminofluorene (N-OH-AAF)-treated Big Blue® rats. The average K-ras codon 12 GGTGTT mutant fraction (MF) for four control rats was 50 x 10–6 (95% CI: 27 x 10–6, 95 x 10–6) and for four treated rats was 165 x 10–6 (95% CI: 87 x 10–6, 312 x 10–6), indicating a 3.3-fold increase with treatment (95% CI: 1.3–8.1). The average MF of K-ras codon 12 GGTGAT for control rats was 1320 x 10–6 (95% CI: 498 x 10–6, 3500 x 10–6) and for treated rats was 8450 x 10–6 (95% CI: 3180 x 10–6, 22 400 x 10–6), indicating a 6.4-fold increase with treatment (95% CI: 1.6–25.4). These transgenic rats were part of a study that included analysis of liver lacI mutations. Although data from lacI determinations show that this compound induces mostly GT mutations, using the ACB-PCR method both K-ras codon 12 GGTGTT and GGTGAT MFs were significantly increased in treated rats versus control rats. This data raises the possibility that N-OH-AAF may not only induce mutations by a genotoxic mechanism, but also by amplification of both de novo and pre-existing K-ras mutation.
 |
Introduction |
|---|
 Top Introduction Materials and methodsResultsDiscussionReferences |
|---|
Non-hereditary carcinogenesis is generally regarded as a combinatorial process with multiple discrete steps. This process is thought to be initiated by DNA damage upon exposure to a carcinogen, with misrepair of a fraction of the DNA lesions. These misrepaired lesions then become persistent mutations. Some of these mutations are in genes that result in altered cellular functions, producing phenotypic changes that are ultimately manifested as visible lesions.
Rodents are often used as animal models for human exposure, risk and disease. Some of the most useful animal models for studying mutagenesis are transgenic rats and mice engineered to carry the Escherichia coli lacI gene shuttle vector (1
). These animals are used for analyzing in vivo somatic cell mutations in any tissue from which sufficient DNA can be recovered. Transgenic rats carrying the lacI shuttle vector (e.g. Big Blue® rats) can be used to determine the frequencies and types of persistent in vivo mutations caused by exposure to test compounds (2–5). However, mutations in the lacI gene do not confer selective growth advantage or other functional changes associated with carcinogenesis, so the relationship of these mutations to proto-oncogene or tumor suppressor gene mutations is not well-defined.
Many of the proto-oncogene and tumor suppressor genes involved in human diseases also are involved in disease processes in animal models, such as the K-ras gene. K-ras codon 12 mutations are frequently observed in both human and rat tumors, with the GGTGTT and GGTGAT mutations accounting for 
32% of observed K-ras codon 12 mutations in human lung, colon, pancreas and uterine tumors (6,7). Because of the predominance of the K-ras mutations in many cancers, it is an important target to measure.
We previously developed an allele-specific, DNA amplification method to measure human K-ras codon 12 point mutations. In this allele-specific competitive blocker PCR (ACB-PCR) assay, the mutant allele is preferentially amplified, while the amplification of the wild-type allele is minimized. Details of this assay are described elsewhere (8,9). Briefly, the assay includes three primers: an extendable mutant-specific primer (MSP), a non-extendable blocker primer (BP) and an extendable downstream primer. To reduce background amplification of the wild-type allele, the MSP is designed with a double mismatch at the 3'-end relative to the wild-type sequence. Although this creates a 3'-penultimate mismatch between the MSP and the mutant allele to be detected, amplification of the mutant allele is greatly favored over amplification of the doubly mismatched wild-type allele. Additionally, a non-extendable primer is added that preferentially anneals to the wild-type allele, blocking these sequences from being primed. The BP has a 3'-double mismatch relative to the mutant allele, so that the blocking of the mutant is minimized.
To date, the ACB-PCR method has been developed for the measurement of human K-ras codon 12 GGTGAT and GGTGTT mutations (9), mouse p53 codon 270 CGTTGT mutation (10), and mouse H-ras codon 61 CAAAAA mutation (11). In a study of H-ras mutation in mice treated with 4-aminobiphenyl (4-ABP), the utility of ACB-PCR was demonstrated by comparing the H-ras mutant fractions (MFs) induced in liver to the tumor burden of like-treated animals. The results indicated that livers of untreated B6C3F1 male mice had an average MF of 1 x 10–5 and livers of treated animals had an average MF of 44.9 x 10–5, a 34.5-fold increase at 8 months after 4-ABP-treatment. A chemical-associated increase in H-ras codon 61 CAAAAA MF was measurable by ACB-PCR and could be correlated with the 4-ABP-induced tumor response, confirming the usefulness of this assay for measuring cancer-related gene mutations.
Relatively little information is available regarding the role of K-ras codon 12 mutations in rat liver tumor development. A few studies have reported data on K-ras codon 12 mutations in rat liver tumors (12–14), with K-ras codon 12 mutations being found only in liver tumors induced by treatment with high doses of nitroglycerin (15). However, the most sensitive mutation detection method applied to the detection of K-ras liver mutation is single-strand conformation polymorphism (SSCP) analysis. The greatest sensitivity reported for SSCP is 3 x 10–3 (16), whereas the sensitivity of ACB-PCR is 1 x 10–5 (9–11). Prior to the current study there were no published data on K-ras mutations in liver and liver tumors of rats treated with N-OH-AAF, and no data describing K-ras mutations in normal-appearing liver tissue of rats treated with hepatic carcinogens.
The ACB-PCR assay for K-ras mutations was first developed for the measurement of human K-ras codon 12 GGTGTT and GGTGAT mutations. With the goal of using ACB-PCR data to inform species extrapolation in cancer risk assessment, we developed assays for quantifying rat K-ras codon 12 GGTGTT and GGTGAT mutations in order to compare the role of K-ras mutations in rat models to human disease. The utility of the developed ACB-PCR assays were then demonstrated in the measurement of mutations in rat liver genomic DNA isolated from a previous study of Big Blue® rats treated with N-hydroxy-2-acetylaminofluorene (N-OH-AAF) (17,18). This approach also provides a direct comparison between the mutational responses in a transgenic reporter locus and an endogenous cancer-associated gene.
|
Materials and methods |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Animal treatment
Liver tissue from a previous study (17
,18) was used for the ACB-PCR assays. Male 6-week-old Big Blue® rats were purchased from Taconic Farms (Germantown, NY). We followed the recommendations set forth by our Institutional Animal Care and Use Committee for the handling, maintenance, treatment and termination of the animals. The animals were given four intraperitoneal (i.p.) doses of 25 mg N-hydroxy-2-acetylaminofluorene (N-OH-AAF)/kg body wt delivered in propane-1,2-diol at 4-day intervals (17). An age matched control group was dosed with four i.p. injections at 4-day intervals with vehicle only (propane-1,2-diol). The i.p. injections were in a volume of 0.8 ml/kg body wt. The rats were sacrificed by CO2 exposure 10 weeks after the initial dose, at age 16 weeks. Livers were collected at necropsy, frozen on dry ice and stored at –80°C.
DNA isolation
Genomic DNA was isolated from rat liver tissue as previously described (19), digested overnight with the EcoRI restriction enzyme (New England Biolabs, Ipswich, MA), extracted with phenol:chloroform:isoamyl alcohol (25:24:1) and the DNA precipitated in 100% ethanol. The DNA was resuspended in 0.5x Tris·EDTA buffer (5 mM Tris–HCl, 0.5 mM EDTA, pH 7.5) and the concentration measured by UV absorbance at 260 nm.
Preparation of K-ras codon 12 wild-type standard and K-ras PCR product from liver samples
DNA isolated from liver of a male 3-week-old F344 rat was used as template in a first-round PCR to produce the wild-type template for the ACB-PCR assay. Because the final sensitivity of the ACB-PCR assay can be no better than the error rate of the DNA polymerase used in the first-round PCR, the high-fidelity enzyme Pfu (Stratagene, La Jolla, CA) was used for amplification of standards and samples. A 304 bp fragment encompassing K-ras exon 1 was amplified in the first-round PCR. Each 100 µl reaction contained: 1 µg of template DNA, 1x Pfu buffer, 0.2 mM each dATP, dTTP, dGTP, dCTP, 1 µM RKR2 (downstream primer, 5'-CTGTACCGATGGTTCCCT-3'), 1 µM RKR5 (upstream primer, 5'-ATATTTTATTATTTTTATTATAAGGCCTG-3'), 10 U Pfu Ultra HotStart (Stratagene). The primers were purchased from Sigma-Genosys (Woodlands, TX). The cycling conditions included a preincubation at 94°C for 2 min, followed by 37 cycles of 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C. The same PCR conditions were used to amplify the K-ras sequence from the livers of control and treated animals.
Preparation of K-ras codon 12 mutant standards
The GAT and GTT mutant standards were generated by in vitro mutagenesis. The reaction conditions for the first-round PCR of the mutant standards (100 µl) were: 1 µg of template DNA, 1x Pfu buffer, 0.2 mM each dATP, dTTP, dGTP, dCTP, 1 µM RKR2 (downstream primer, 5'-CTGTACC GATGGTTCCCT-3'), 1 µM mutagenic primer, 10 U Pfu Ultra HotStart (Stratagene). The cycling conditions were initiated with a pre-incubation at 94°C for 2 min, followed by 37 cycles of 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C. The sequence of the GTT mutagenic primer was 5'-ATATTTTATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAGTATAAACTTGTGGTAGTTGGAGCTGTTGGCGTAGG -3'. The sequence of the GAT mutagenic primer was 5'-ATATTTTATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAGTATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGG-3'.
First-round PCR product verification and isolation
The size of the first-round PCR products of all standards and samples were verified by electrophoresis in 1.2% agarose gels with ethidium bromide staining. Once verified, the first-round PCR products were purified by electrophoresis in 0.7% agarose gels. The 304 bp bands of DNA were excised from the agarose and the DNA isolated from the gel slices using a GENECLEAN®SPIN Kit (Q-Biogene, Irvine, CA). The isolated DNA was quantified using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE).
ACB-PCR conditions
Using the mutant and wild-type DNA fragments produced in the first-round PCR, MF standards of 10–1, 10–2, 10–3, 10–4 and 10–5 were prepared. The MF standards contained a final concentration of 0.5 x 108 K-ras codon 12 copies per µl. For the ACB-PCR assay, 4 µl of each standard was used, resulting in a total of 2 x 108 K-ras copies in each reaction, and the same number of molecules (produced in the first-round PCR) were analyzed for each unknown sample. Two controls were also included in each ACB-PCR assay: a no-mutant control consisting of 2 x 108 copies of wild-type K-ras standard, and a no-DNA control consisting of 4 µl of water instead of template. The ACB-PCR reactions were setup as previously described including the same primers (9), but with the specific reaction and cycling conditions optimized for the rat K-ras codon 12 GTT and GAT mutations (Table I). The method requires three primers; a downstream primer, a 5'-fluorescein-labeled MSP, and a BP terminating in a 3'-dideoxynucleotide. All three primers were purchased from Sigma Genosys, with the MSPs and BPs ordered as purified by PAGE. The ACB-PCR were initiated using a hot-start procedure by the addition of AmpliTaq DNA Polymerase Stoffel fragment (Applied Biosystems, Foster City, CA) and PerfectMatch® PCR enhancer (Stratagene).
|
Analysis of ACB-PCR products
Equal volumes of ACB-PCR products were analyzed by PAGE using 8% polyacrylamide/TAE gels run for 2.5 h at 200 V. In the initial assay for each mutant, the size of the ACB-PCR products were verified against a DNA molecular weight ladder and subsequent staining with VistraGreen® (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) (data not shown). Due to incorporation of the fluorescein-labeled MSP, the K-ras PCR product is fluorescent and the fluorescein-labeled DNA product band in each subsequent assay was detected using a FluorImager® (GE Healthcare Bio-Sciences Corp.) and quantified using ImageQuaNTTM (GE Healthcare Bio-Sciences Corp) software. The fluorescence detected from the MF standards was quantified as number of pixels by the ImageQuaNTTM software and used to construct a standard curve. Three replicate experiments were performed to quantify the K-ras codon 12 GGT to GTT and GGT to GAT MFs in each liver DNA sample.
Statistical analysis
A standard curve for each assay was constructed by taking the logarithm of the number of pixels reported for each standard sample and fitting the data with a linear regression. The number of pixels observed for each unknown sample was converted to log10 and the MF calculated using this calibration. Statistical analyses were performed using analysis of variance and the results reported with one-sided P-values. Data values of MFs < 1 x 10–5 (below the limit of detection) were deleted from the analyses.
|
Results |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Genomic DNA from N-OH-AAF-treated and control Big Blue® rat livers was isolated and the K-ras codon 12 region amplified. The 304 bp fragment was quantified and used as template in the ACB-PCR analyses. A total of 2 x 108 copies of the K-ras codon 12 fragment was analyzed for each sample, and the ACB-PCR assays were performed in triplicate for both the K-ras codon 12 GGT
GTT and GGTGAT MF determinations.
A representative K-ras codon 12 GGTGTT analysis is shown in Figure 1A. As expected, the fluorescently labeled ACB-PCR product is a 103 bp band. The pixel count from each standard band was transformed to its log10 base and plotted against the log10 base of its MF (Figure 1B). The equation describing the linear regression produced for these samples was then used to estimate the MFs of each unknown sample. The estimations from three assays, along with the mean and the 95% confidence interval, are listed in Table II.
|
|
A representative K-ras codon 12 GGT
GAT analysis are shown in Figure 2A. Again, the fluorescent product was the correct size. The pixel count from each standard band was transformed to its log10 base and plotted against the log10 base of the MF (Figure 2B). The equation of this regression was then used to estimate the MFs of each sample. The estimations from three experiments, along with the mean and 95% confidence interval, are listed in Table III.
|
|
In both the GTT and GAT MF assays, one control animal (animal 1) in Tables II and III, had MFs significantly greater than the other control animals (GAT: P = 0.0069, GTT: P = 0.0009) and greater than the treated animals (GAT: P = 0.0990, GTT: P = 0.0070). The MF estimates for this animal are presumed to be valid, as they were repeated in the three assays. However, these data were excluded from the control group in subsequent analyses because the MF observed in this animal was significantly different from the other animals. If included in the control group, the average MFs observed in treated animals remained larger than that of control animals although these differences were no longer statistically significant.
Analyses of variance were conducted using the data in Tables II and III. As discussed above, all data from animal 1 was excluded. Additionally, two other assays were excluded because the estimated MF was below the limit of detection (1.0 x 10–5) and are marked as excluded in Tables II and III. Analyses were on the logarithms of the MF because the variation among assays within animals is relatively constant on the logarithmic scale. The variation among animals within treatments was not significant relative to the variation between repeated assays of the same animals (GAT: P = 0.099; GTT: P = 0.682). Most importantly, the mean MFs of the treated animals were significantly greater than the mean MF of the control animals relative to variation among animals within treatments for both mutations (GAT: P = 0.017; GTT: P = 0.018). Sampling errors as defined by Poisson's distribution, in addition to pipetting errors and variability in the ACB-PCR amplification efficiency, contribute to the variability between the assays and has been discussed previously (7).
The average MF of K-ras codon 12 GGTGTT for the control rats was 50 x 10–6 (95% CI: 27 x 10–6, 95 x 10–6) and for the treated rats was 165 x 10–6 (95% CI: 87 x 10–6, 312 x 10–6), a 3.3-fold increase (95% CI: 1.3, 8.1). The average K-ras codon12 GGTGAT MF for the four control rats was 1320 x 10–6 (95% CI: 498 x 10–6, 3500 x 10–6) and for the four treated rats it was 8450 x 10–6 (95% CI: 3180 x 10–6, 22400 x 10–6), a 6.4-fold increase (95% CI: 1.6, 25.4). Additionally, there is a striking difference in the levels of the two mutations, with control GAT MF being 26.4-fold greater than control GTT, and treated GAT MF 51.2-fold greater than the treated GTT MF.
|
Discussion |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The ACB-PCR method can quantify the fraction of K-ras mutant alleles in any tissue, which enables studies of K-ras MF measurements during the progression of carcinogenesis in rat models and compared to K-ras MF data from human tissue. The ACB-PCR method was developed for the measurement of rat K-ras codon 12 GGT
GTT and GGTGAT MFs as was previously done for the human K-ras codon 12 mutations (9). The rat ACB-PCR conditions were similar, showing that this method is portable and is becoming easily adaptable in establishing assays with a sensitivity of 10–5 for new mutations. To validate the rat K-ras codon 12 GGTGTT and GGTGAT ACB-PCR assays, MFs were measured and compared in Big Blue® rat liver DNA samples of control and N-OH-AAF-treated rats (17). For the rat K-ras codon 12 GGTGTT mutation, the mean MF of control animal samples was 50 x 10–6 and for treated samples it was 165 x 10–6, a significant 3.3-fold increase (Table II). For the K-ras codon 12 GGTGAT mutation, the mean MF of controls was 1320 x 10–6 and for treated it was 8450 x 10–6, a significant 6.4-fold increase (Table III).
The results from the liver K-ras mutation ACB-PCR measurements are herein compared with the results from the liver lacI studies previously reported (17,18). The ACB-PCR assay MF data can be logically compared to the lacI assay mutant frequency data because both assays report the fraction of a cell population containing a mutation. The lacI assay reports mutant frequency calculated from the ratio of mutant plaques to total plaques measured, and the ACB-PCR method reports the fraction of mutant alleles to the total population of alleles. However, some differences need to be pointed out before comparisons are made. First, the reported liver lacI mutation spectra were from livers of rats 6 weeks after initial dosing with four doses of 25 mg/kg bodt wt. N-OH-AAF (100 mg/kg body wt total). However, the ACB-PCR analyses were performed using liver samples of rats 10 weeks after initial dosing with four doses of 25 mg/kg body wt N-OH-AAF. This time point was chosen in order to validate the ACB-PCR assay with samples having the greatest likelihood of measurable K-ras MFs. It is not known if the mutant frequency of lacI is constant from 6 to 10 weeks after treatment; however, the hprt mutant frequency in spleen lymphocytes was not significantly different between the 6- and 10-week 100 mg N-OH-AAF dose samples (17), which suggests that the lacI gene mutation frequency may also be stable in the same time period.
The lacI mutant frequencies for the GT and GA mutants were calculated using the mutation spectra data and the overall mutant frequency data (Table IV). For control rats, the average lacI mutant frequency was 25.7 x 10–6, with GT mutations accounting for 18% of these mutations. The GT mutant frequency was estimated by multiplying the total mutant frequency by 0.18 resulting in a GT mutant frequency of 4.7 x 10–6. The GA mutations in control rats account for 41% of the control mutations, therefore the lacI GA mutant frequency can be estimated as 10.5 x 10–6. In the treated group, the average mutant frequency was 406.8 x 10–6. The GT mutations account for 34%, while GA mutations account for 20% of the total mutations, giving estimated mutant frequencies of 140 x 10–6 and 81 x 10–6, respectively. The absolute mutant frequency per G:C basepair was then derived by accounting for the number of mutable G:C sites in the lacI transgene. Using data from the database described by Cariello et al. (20) and new G:C sites described in the N-OH-AAF treated animals (18), it is estimated that there are 152 mutable G:C sites. The calculated absolute mutant frequencies per basepair are reported in Table IV.
|
Comparison of the data in Tables II and III shows K-ras MFs are much greater than expected based upon the lacI assay results. The control K-ras codon 12 GGT
GTT and GGTGAT measurements are 50 x 10–6 and 1320 x 10–6, 1700-fold and 19 000-fold greater than the lacI mutant frequency per mutable site, respectively. For the treated groups, the K-ras codon 12 GGTGTT MF is 165 x 10–6 (180-fold greater than the lacI GT MF per mutable site) and the GGTGAT MF is 8450 x 10–6 (16 000-fold greater than lacI GA mutant frequency per mutable site). This illustrates that a neutral exogenous gene and a potentially cancer-related endogenous gene are strikingly dissimilar and this is attributable to differences in de novo mutation, clonal growth of de novo mutation, and clonal expansion of pre-existing mutation.
Exposure to N-OH-AAF primarily induces GT transversions in a variety of targets including bacterial and mammalian genes (21). Because of this mutational specificity, the induced K-ras GGTGTT MF may provide an approximation of the chemically-induced de novo mutation and subsequent expansion of these de novo mutations at K-ras codon 12. When the GTT measurements are subtracted from the N-OH-AAF-induced K-ras GAT measurements, a MF of 4900 x 10–6, or 98% of the K-ras GAT MF, remains unaccounted for. This suggests that the remaining GAT MF may represent expansion of pre-existing mutant cells, the presence of which is corroborated by the high level of K-ras GAT MF in control animals. This interpretation of the data supports the hypothesis that the increase of a specific mutation in a tumor after carcinogen exposure may be due in large part to expansion of pre-existing mutations (16,22).
In this study, the animal livers are still growing from adolescent to adult size. In this biological environment of growth during chemical treatment, the pre-existing mutant cells may gain a proliferative advantage until the liver is full size, thereby causing a greater K-ras MF in the treated animal livers versus the control animal livers. A more thorough investigation to discern clonal expansion from hot-spot de novo mutations requires a time-course study that includes an early time point after treatment and multiple small samples from each tissue to address the distribution of the mutant clones. Whether due to clonal expansion or hot-spot mutation, it is evident from the current study that treatment with N-OH-AAF increases the K-ras codon 12 GGTGTT and GGTGAT MFs in normal-appearing treated rat livers versus control rat livers. The K-ras mutant cells may have acquired one of the hallmarks of cancer, increased proliferation (23), which potentially constitutes a field from which tumorigenesis is more likely to proceed (7).
An anomaly is presented by the one control rat which has a K-ras codon 12 GGTGAT MF of 49 800 x 10–6 and GGTGTT MF of 879 x 10–6, values greater than expected relative to the other control animals. The F344 rat rarely develops sporadic liver tumors, so this high MF level raises the question regarding the role of K-ras mutations in the carcinogenic process in rat liver. K-ras mutations may cause a cellular functional change of increased and continuous MAPK pathway activation, which may be a necessary, but not rate-limiting, part of the carcinogenic process (24). Tumor development and carcinogenesis is a complex process in which polyclonal interactions may be a major contributor to overall growth and selection advantage. The exponential increase in the number of aberrant cells during carcinogenesis may be due to the mutual advantage of different clones of cells growing together in close proximity (25–27).
The present study illustrates how the ACB-PCR assay for tumor-related mutations, such as K-ras mutations, has the potential to distinguish whether a chemical's mode of action is due to de novo mutations (i.e. genotoxic) or due to expansion of pre-existing mutations (i.e. non-genotoxic). K-ras mutations are considered to be an integral part of tumorigenesis in a number of important cancers, and therefore is a relevant biological marker of both cause and effect of exposure to mutagenic compounds. The ACB-PCR method can quantify the fraction of K-ras mutant alleles in any tissue and provides both quantitation and a sensitivity of 1 x 10–5 that could be used for collecting data from low dose exposure experiments, as well as data for incorporation into a mathematical model of the carcinogenic process. Additionally, the ACB-PCR method has been developed for the human K-ras codon 12 GGTGAT and GGTGTT mutations so that parallel assays could be employed to compare the mutational load in rat and human tissues. ACB-PCR measurement of K-ras mutation in both species is an important initial step in making relevant extrapolations from a test animal model to human disease.
|
Acknowledgments |
|---|
We thank Drs Robert Heflich, Fred Beland and Martha Moore for constructive and lively discussions, along with editorial review, of the work described herein. The views presented in this article do not necessarily reflect those of the Food and Drug Administration.
|
Notes |
|---|
*To whom correspondence should be addressed: Tel: +1 870 543-7399; Fax: +1 870 543-7393; Email: page.mckinzie{at}fda.hhs.gov
|
References |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
-
1. Dycaico M.J., Provost G.S., Kretz P.L., Ransom S.L., Moores J.C., Short J.M. (1994) The use of shuttle vectors for mutation analysis in transgenic mice and rats. Mutat. Res. 307:461–478.[Web of Science][Medline]
2. Manjanatha M., Shelton S., Bishop M., et al. (2004) Analysis of mutations and bone marrow micronuclei in Big Blue rats fed leucomalachite green. Mutat. Res. 547:5–18.[Web of Science][Medline]
3. Mei N., Chou M., Fu P., Heflich R., Chen T. (2004) Differential mutagenicity of riddelliine in liver endothelial and parenchymal cells of transgenic big blue rats. Cancer Lett. 215:151–158.[CrossRef][Web of Science][Medline]
4. Mei N., Guo L., Fu P., Heflich R., Chen T. (2005) Mutagenicity of comfrey (Symphytum Officinale) in rat liver. Br. J. cancer 92:873–875.[CrossRef][Web of Science][Medline]
5. Topinka J., Oesterle D., Reimann R., Wolff T. (2004) No-effect level in the mutagenic activity of the drug cyproterone acetate in rat liver. Part I. Single dose treatment. Mutat. Res. 550:89–99.[Web of Science][Medline]
6. Bos J.L. (1988) The ras gene family and human carcinogenesis. Mutat. Res. 195:255–271.[CrossRef][Web of Science][Medline]
7. McKinzie P., Delonchamp R., Heflich R.H., Parsons B. (2001) Prospects for applying genotypic selection of somatic oncomutation to chemical risk assessment. Mutat. Res. 489:47–78.[CrossRef][Web of Science][Medline]
8. Parsons B., McKinzie P., Heflich R. (2005) Allele-specific competitive blocker-PCR detection of rare base substitution. Methods Mol. Biol. 291:235–245.[Medline]
9. McKinzie P.B. and Parsons B.L. (2002) Detection of rare K-ras codon 12 mutations using allele-specific competitive blocker PCR. Mutat. Res. 517:209–220.[Web of Science][Medline]
10. Verkler T., Couch L.H., Howard P.C., Parsons B.L. (2005) Quantifying levels of p53 mutation in mouse skin tumors. Environ. Mol. Mutagen. 45:427–434.[CrossRef][Web of Science][Medline]
11. Parsons B.L. and Heflich R.H. (1998) Detection of a mouse H-ras codon 61 mutation using a modified allele-specific competitive blocker PCR genotypic selection method. Mutagenesis 13:581–588.
12. Komulainen H., Hakulinen P., Servomaa K., Makkonen K., Vasara R., Maki-Paakkanen J., Kosma V.M. (2000) No consistent pattern of mutations in p53 and ras genes in liver tumors of rat treated with the drinking water mutagen 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX). Environ. Mol. Mutagen. 36:292–300.[CrossRef][Web of Science][Medline]
13. Kawamori T., Totsuka Y., Uchiya N., Kitamura T., Shibata H., Sugimura T., Wakabayashi K. (2004) Carcinogenicity of aminophenylnorharman, a possible novel endogenous mutagen, formed from norharman and aniline, in F344 rats. Carcinogenesis 25:1967–1972.
14. Matsumoto K., Iwase T., Hirono I., et al. (1997) Demonstration of ras and p53 gene mutations in carcinomas in the forestomach and intestine and soft tissue sarcomas induced by N-methyl-N-nitrosourea in the rat. Jpn. J. Cancer Res. 88:129–136.[CrossRef][Web of Science]
15. Tamano S., Ward J.M., Diwan B.A., Keefer L.K., Weghorst C.M., Calvert R.J., Henneman J.R., Ramljak D., Rice J.M. (1996) Histogenesis and the role of p53 and K-ras mutations in hepatocarcinogenesis by glyceryl trinitrate (nitroglycerin) in male F344 rats. Carcinogenesis 17:2477–2486.
16. Cha R.S., Thilly W.G., Zarbl H. (1994) N-Nitroso-N-methylurea-induced rat mammary tumors arise from cells with preexisting oncogenic Hras1 gene mutations. Proc. Natl Acad. Sci. USA 91:3749–3753.
17. Chen T., Mittelstaedt R.A., Aidoo A., Hamilton L.P., Beland F.A., Casciano D.A., Heflich R.R. (2001) Comparison of hprt and lacI mutant frequency with DNA adduct formation in N-hydroxy-2-acetylaminofluorene-treated Big Blue® rats. Environ. Mol. Mutagen. 37:195–202.[CrossRef][Web of Science][Medline]
18. Chen T., Mittelstaedt R.A., Shelton S.D., Dass S.B., Manjanatha M.G., Casciano D.A., Heflich R.H. (2001) Gene- and tissue-specificity of mutation in Big Blue® rats treated with the hepatocarcinogen N-hydroxy-2-acetylaminofluorene. Environ. Mol. Mutagen. 37:203–214.[CrossRef][Web of Science][Medline]
19. Ausubel F.M., Brent R., Kingston R.E., Moore D.D., Seidman J.G., Smith J.A., Struhl K. eds. (1992) Preparation of genomic DNA from mammalian tissue. Short Protocols in Molecular Biology(Greene Publishing Associates and John Wiley & Sons, New York).
20. Cariello N.F., Cui L., Skopek T.R. (1994) In vitro mutational spectrum of aflatoxin B1 in the human hypoxanthine guanine phosphoribosyltransferase gene. Cancer Res. 54:4436–4441.
21. Heflich R.H. and Neft R.E. (1994) Genetic toxicity of 2-acetylaminofluorene, 2-aminofluorene and some of their metabolites and model metabolites. Mutat. Res. 318:73–174.[CrossRef][Web of Science][Medline]
22. Thilly W. (2003) Have environmental mutagens caused oncomutations in people? Nat. Genet. 34:255–259.[CrossRef][Web of Science][Medline]
23. Hanahan D. and Weinberg R.A. (2000) The hallmarks of cancer. Cell 100:57–70.[CrossRef][Web of Science][Medline]
24. Schleger C., Heck R., Steinberg P. (2000) The role of wild-type and mutated N-ras in the malignant transformation of liver cells. Mol. Carcinog. 28:31–41.[CrossRef][Web of Science][Medline]
25. Novelli M., Williamson J., Tomlinson I., Elia G., Hodgson S., Talbot I., Bodmer W., Wright N. (1996) Polyclonal origin of colonic adenomas in an XO/XY patient with FAP. Science 272:1187–1190.[Abstract]
26. Merritt A., Gould K., Dove W. (1997) Polyclonal structure of intestinal adenomas in ApcMin/+ mice with concomitant loss of Apc+ from all tumor lineages. Proc. Natl Acad. Sci. USA 94:13927–13931.
27. Thliveris A., Halberg R., Clipson L., Dove W., Sullivan R., Washington M., Stanhope S., Newton M. (2005) Polyclonality of familial murine adenomas: analyses of mouse chimeras with low tumor multiplicity suggest short-range interactions. Proc. Natl Acad. Sci. USA 102:6960–6965.
Received on May 26, 2006; revised on August 18, 2006; accepted on August 21, 2006.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||