Mutagenesis Advance Access originally published online on December 8, 2006
Mutagenesis 2007 22(1):49-54; doi:10.1093/mutage/gel050
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press 2006
Cisplatin–DNA damage in p21WAF1/Cip1 deficient mouse keratinocytes exposed to cisplatin
1 Laboratory of Cellular Carcinogenesis and Tumor Promotion, CCR, National Cancer Institute, Building 37 Room 4032, NIH Bethesda, MD 20892-4255 2 Laboratory of ImmunoBiology, Office of Biotechnology Products, CDER, US Food and Drug Administration Bethesda, MD 20892 3 Valley City State University, 101 College Street S.W. Valley City, ND 58072 4 Department of Oncology, Mayo Clinic 200 First Street SW., Rochester, MN 55905, USA
In response to DNA damage, cell cycle arrest, apoptosis, and DNA repair are mediated by a TP53 pathway that induces p21WAF1/Cip1. The chemotherapeutic drug cis-diamminedichloroplatinum-II (cisplatin) damages cellular DNA by forming cis-diammineplatinum-N7-d[GpG] and cis-diammine-platinum-N7-d[ApG] adducts. To investigate the role of p21, skin keratinocytes from p21WAF1/Cip1 wild-type (+/+), heterozygous (+/–), and null (–/–) mice, cultured in calcium levels designed to maintain a proliferating state, were exposed to 5 µM cisplatin continuously for 0, 8, 24, 48 and 72 h. At all time points the (+/–) cells had the fewest Pt-DNA adducts, and at 24 h mean Pt-DNA adduct levels were 541, 153 and 779 fmol adduct/µg DNA for p21WAF1/Cip1 (+/+), (+/–) and (–/–) cells, respectively [P < 0.05 for (+/+) versus (+/–) and (–/–) versus (+/–)]. In order to understand underlying events, we examined p21WAF1/Cip1 messenger RNA (mRNA), cell cycle arrest, and apoptosis in these cells. At 48 h of cisplatin exposure p21WAF1/Cip1 mRNA expression was 2-fold higher in the (+/+) cells, compared to the (+/–) cells. At 24 h, the % of cells in S-phase in cisplatin-exposed cultures, compared to unexposed cultures, was decreased by 51, 40 and 11% in p21WAF1/Cip1 (+/+), (+/–) and (–/–) cells, respectively (P = 0.04, ANOVA). At 24, 48 and 72 h the % of cisplatin-exposed (+/+) cells in apoptosis was 9.4–10.5%, while the cisplatin-exposed (+/–) and (–/–) cells had 1.2–3.7% of cells in apoptosis. The data support the interpretation that DNA replication arrest and apoptosis do not completely explain the low levels of Pt-DNA adducts in the (+/–) cells, and suggest that p21WAF1/Cip1 controls activity resulting in either low Pt-DNA adduct formation or enhanced Pt-DNA adduct removal.
 |
Introduction |
|---|
 Top Introduction Materials and methodsResultsDiscussionReferences |
|---|
Multiple studies have attempted to address the complex interactions between the biological functions of the p21 (WAF1/Cip1/Sdi1/Cdn1,CDKN1A) protein and DNA damage response. p21 plays a dual role in cell cycle arrest by blocking entry of cells into S-phase through inhibition of cyclin-Cdk complexes (1
–3), and by binding to proliferating cell nuclear antigen (PCNA) and thus arresting the processivity of the DNA polymerase (1,4,5). Beyond inducing cell cycle arrest, the specific role of p21 in DNA repair has been surrounded by controversy and conflicting results (1,6–15). A survey of the literature shows variable activities depending on the use of: cultured whole cells versus cell extracts; host-cell reactivation versus unscheduled DNA synthesis DNA repair assays; and normal versus cancer cells (1,6–15). Furthermore, interactions between DNA replication, apoptosis and DNA repair in DNA damage response appears to vary with cell type, species and organ of origin, and choice of DNA damaging agent (1,6–15).
Many genotoxic chemical carcinogens become covalently bound to DNA and are removed by DNA repair mechanisms. Cisplatin, a drug highly effective in the chemotherapy of epithelial cancers, including testicular, ovarian and lung cancers (16), forms bidentate intrastrand Pt-d(GpG) and Pt-d(ApG) adducts that are chemically stable, persistent, block DNA replication and are removed by nucleotide excision repair (17). The mechanisms by which normal cells respond to cisplatin-induced DNA damage are relevant to issues of both drug efficacy and drug toxicity, and are intimately associated with the cellular processes of proliferation, apoptosis, and DNA repair.
We have applied a set of novel keratinocyte cell lines derived from mice deficient in p21WAF1/Cip1 as a model to study the contribution of p21WAF1/Cip1 to DNA damage response in normal epithelial tissues. These lines were derived from skin keratinocytes of newborn mice that were either wild-type (+/+), heterozygous (+/–), or homozygous (–/–) for a null mutation in the p21WAF1/Cip1 gene (18,19). Cultured cells of each genotype were exposed continuously to cisplatin, a direct-acting DNA damaging agent, and samples were taken at 0, 8, 24, 48 and 72 h. In order to explore the relationship between p21WAF1/Cip1 gene dose and cell-cycle arrest, apoptosis and cisplatin-DNA adduct formation, these parameters were evaluated during the first 72 h of cisplatin exposure.
|
Materials and methods |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Derivation of cell lines, cell culture and cisplatin exposure
Primary keratinocytes were isolated from transgenic newborn mice either wild-type (+/+), heterozygous (+/–), or homozygous (–/–) for a null mutation in the p21WAF1/Cip1 gene (18
,19), and cell lines were derived using methods similar to those described previously (20). Cultures were maintained in the proliferating state in calcium-free Eagle's Minimal Essential Medium with Earle's balanced salt solution (BioWhittaker, Walkersville, MD). The medium contained 8% chelexed fetal bovine serum (Sigma, St Louis, MO) and keratinocyte growth factor (1 ng/ml) (R&D Systems, Minneapolis, MN), with a final Ca++ concentration of 0.05 mM (21). Growth rates were compared for several independent lines of each p21WAF1/Cip1 genotype, and a set of lines with similar proliferation rates were chosen for these experiments. The cell lines used were as follows: W1#9 for (+/+); W3HET3.4B for (+/–); and W3KO1B for (–/–). Cells (0.9–2.4 x 106) were cultured for 24 h to 50% confluency, and then exposed to 5 µM cisplatin continuously for 72 h without a medium change.
All cell lines were genotyped by PCR as in Weinberg et al. (19). Briefly, cells were lysed in buffer containing 50 mM Tris–HCl, 0.1 M EDTA, 0.1 M NaCl and 1.0% SDS, and incubated first with RNase A for 1 h at 37°C and then with Proteinase K for 1 h at 70°C. The lysate was extracted once with phenol:chloroform:isoamyl alcohol and DNA was precipitated with ethanol. DNA was resuspended in water and diluted to 50 µg/ml for PCR. Amplification of the wild-type p21WAF1/Cip1 allele produced a 295 bp PCR product (F: TGTCCAATCCTGGTGATGTC; R: CAGGGCAGAGGAAGTACTGG), while amplification of the knockout allele produced a 178 bp PCR product (F: GTTGTCCTCGCCCTCATCTA; R: CCAGACTGCCTTGGGAAA).
Cell survival by trypan blue exclusion
Mouse keratinocytes in log-phase growth were exposed to 0 or 5 µM cisplatin in vehicle (PBS) for 0, 8, 24, 48 and 72 h. Floating and attached cells were removed from the dish using Costar 3008 cell lifters (Corning Incorporated, Corning, NY), gently transferred to tubes and centrifuged for 10 min at 400x g. After removal of the supernatant, 0.5–1.0 ml of trypan blue (0.4%, Gibco, Gaithersburg, MD) was added and a minimum of 100 cells (40 fields) was counted in a counting chamber. On three separate occasions, independent survival experiments were performed, each with three dishes per point. For individual experiments the data were expressed as number of viable cells/number of total cells x100 (% viable cells).
Real-time PCR of p21WAF1/Cip1 messenger RNA
Mouse keratinocytes were grown to 30% confluence and exposed to either 0 or 5 µM cisplatin for 24 or 48 h. The cells were lysed with 1.0 ml of Trizol reagent (Invitrogen Corp, Carlsbad, CA) and RNA was extracted according to the manufacturer's protocol. Residual DNA was removed with DNaseI digestion and the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) was used to prepare cDNA from 1.0 µg of RNA. All RT–PCR reactions were performed using the MyIQ Single Color Real Time Detection System (Bio-Rad) and RT–PCR was performed using the SYBR Premix Ex Taq Perfect Real Time kit (Takara Mirus Bio Inc, Madison, WI) according to the manufacturer's protocol. Real-time amplification of the p21WAF1/Cip1 mRNA was performed using the following primers: F: GCTGTCTTGCACTCTGGTGT; R: TCTGCGCTTGGAGTGATAGA. Amplification of mRNA from GAPDH was used to normalize between samples.
Apoptosis by flow-cytometry
Mouse keratinocytes in log-phase growth were exposed to 0 or 5 µM cisplatin, harvested and processed for flow-cytometry (FACSCalibur, BD Biosciences, San Jose, CA) using the TUNEL-based APO-BRDU KitTM (BD Biosciences), according to the manufacturer's instructions. Floating and attached cells were incubated with DNA labelling solution containing BrdU, harvested at 0, 8, 24, 48 or 72 h of cisplatin exposure and subsequently fixed with 1% paraformaldehyde. After washing, samples were incubated with fluorescein-labelled anti-BrdU, pelleted and washed with wash buffer. Cells were incubated with RNAse/Propidium iodide solution provided by the APO-BRDU KitTM and kept in the dark at 4°C overnight. Cells were passed through a fluorescence activated cell sorter (FACSCalibur, BD Biosciences) using the doublet discrimination module, and data were acquired using CellQuest (BD Biosciences) software. The cell cycle was modelled and data expressed as percentage of apoptotic cells in the total cell preparation.
Cell cycle parameters determined by BrdU incorporation and flow-cytometry
Mouse keratinocyte DNA synthesis was evaluated by flow-cytometry (FACSCalibur, BD Biosciences) of BrdU-labelled cells using the fluorescein isothiocyanate-conjugated Mouse Monoclonal Antibody kit (BD Biosciences). Actively growing cells exposed to either 0 or 5 µM cisplatin for 0, 8, 24, 48 or 72 h, were pulsed for 1 h with 10 µM BrdU before harvest. At harvest, plates were washed and attached cells were removed from the bottom of the dish using Costar 3008 cell lifters (Corning Inc.). Cells were pelleted and washed with culture medium without serum. Cells were then fixed in 1 ml of ice-cold 70% ethanol dropped while vortexing. Following an overnight fixation at 4°C, cells were pelleted by centrifugation and incubated with 50 µl (100 units) of RNAse (Qiagen, Valencia, CA) at room temperature for 20 min. After washing, samples were incubated with fluorescein-labelled anti-BrdU and pelleted. Propidium iodide (500 µl of 10 µg/ml) (Sigma) was added to each cell suspension and cells were kept in the dark at 4°C overnight. Cells were passed through the fluorescence activated cell sorter using the doublet discrimination module, and data were acquired using CellQuest (BD Biosciences) software. Percentages of cells in S- and G1-phases were calculated directly by the software.
Preparation of DNA and cisplatin-DNA adduct measurement by chemiluminescence immunoassay (CIA)
For two experiments mouse keratinocytes in log-phase growth were exposed to 0 or 5 µM cisplatin in vehicle (PBS) for 0, 8, 24, 48 or 72 h, and for four additional experiments the same cells were exposed to 0 or 5 µM cisplatin for 0 and 24 h. After washing, attached keratinocytes were removed from the plates using Costar 3008 cell lifters (Corning Inc.). Extraction of DNA from harvested attached cells was performed using the Intergen DNA extraction kit (Intergen, Purchase, NY), with additional RNAse incubation and reprecipitation of the final product. DNA concentration was determined by spectrophotometry at A260.
Microtitre plates were 96-well high-binding LIA plates (Greiner Labortechnik, FRG). The CIA-specific reagents, including biotinylated anti-rabbit IgG, Avidin-Alkaline Phosphatase (Avidix-AP), 0.25% casein (I block), assay buffer and CDP-Star with Emerald II were obtained from Tropix (Bedford, MA). All washes were performed with PBS containing 0.05% Tween-20 and 0.05% of NaN3 (PBST, KD Medical, Columbia, MD), and unless otherwise specified were carried out for three cycles using an automated microtitre plate washer (Ultrawash Plus, Dynatech Laboratories, Gaithersburg, MD).
DNA adducts were measured by competitive cisplatin-DNA CIA using an approach similar to that described previously for benzo(a)pyrene–DNA adducts (22,23). Briefly, microtitre plates were washed and incubated for at least 24 h with 0.2 ml DEAE-Dextran (Pharmacia, Uppsala, Sweden) (0.06 µg/ml) at 4°C, before coating with 10.0 fmol Pt adduct in cisplatin–DNA (2.3% modified). The plates were incubated uncovered at 37°C for 24–48 h to allow evaporation of the liquid, and then stored at –20°C until use. For the assay, plates were thawed and washed. After addition of 0.25% casein in PBST (200 µl/well) plates were incubated at 37°C for 1 h to reduce non-specific antibody binding. Anti-cisplatin–DNA antibody (rabbit #75, 9/28/84 bleed, diluted to 1:4 00 000 in 0.25% casein) (24) was added to an equal volume of serially diluted cisplatin–DNA standard (4–3109 fmol of Pt adduct in DNA modified at 40 adducts per 106 nt) (25), or test DNA sample, in PBS, mixed and incubated at 37°C for 15 min. The DNA content of the standard curve wells was matched to the DNA in sample wells by adding appropriate amounts of sonicated and denatured carrier calf thymus DNA to normalize the matrix effect. The final combination of DNA and cisplatin–DNA antibody was mixed and incubated at 37°C for 15 min before being added to the microtitre plate wells and incubated for 90 min at 37°C. After washing, biotinylated anti-rabbit IgG (1: 5000 dilution in 0.25% casein in PBST) was added and the plate incubated for an additional 90 min at room temperature. Plates were washed, and Avidin-Alkaline Phosphatase (1:8000 in 0.25% casein in PBST) was added and incubated at room temperature for 60 min. Next the plates were washed with PBST and two cycles of distilled water. Subsequently, 310 µl of assay buffer was added to the wells and incubated 3–5 min. Plates were emptied and CDP-Star containing Emerald II enhancer (100 µl) was added and plates were kept at 4°C overnight. The next day plates were warmed to room temperature and luminescence was read using a TR717 Microplate Luminometer (PE Applied Biosystems, Foster City, CA) at 542 nm. The standard curve 50% inhibition (mean ± SE, n = 6) was 581.2 ± 36.2 fmol Pt per well, and the lower limit of detection, using 20 µg of DNA per well, was 
2 fmol Pt/µg DNA or 66 adducts/108 nt.
Statistics
To evaluate differences in p21WAF1/Cip1 mRNA levels in cisplatin-exposed, compared to unexposed, (+/+) and (+/–) cultures, an F-test was used to determine that the sample variances were unequal and the Welch's t-test was therefore used to determine that the cisplatin-induced p21WAF1/Cip1 mRNA levels were significantly higher. To evaluate differences in cisplatin–DNA adduct formation for the six experiments at 24 h, statistical significance was first evaluated with the Kruskal–Wallis one-way ANOVA, followed by pairwise comparison for (+/+) versus (+/–) and (–/–) versus (+/–) using the Student–Newman–Keuls method. In addition, the groups were compared using the Mann–Whitney Rank Sum t-test. To evaluate differences in cisplatin–DNA adduct formation among the different groups for the two experiments at 48 h, two-sided t-tests were performed on log-transformed data. Two-sided t-tests were also used to evaluate the % of cells in S-phase in the presence or absence of cisplatin and the differences in p21WAF1/Cip1 mRNA levels. ANOVA with contrasts was used to compare the difference in % of cells in S-phase for cisplatin and unexposed cells by p21WAF1/Cip1 (+/+) and (–/–) status.
|
Results |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Characterization of keratinocyte cell lines from p21WAF1/Cip1 transgenic mice
Keratinocyte cell lines were derived from the skin of newborn mice differing only in p21WAF1/Cip1 gene dose. The lines used, W1#9, W3HET3.4B, and W3KO1B, were (+/+), (+/–) and (–/–), respectively, for a null mutation in the p21WAF1/Cip1 gene. These cells, which are not transformed, have the advantage of continuous passaging by virtue of the proliferation allowed under low Ca++ conditions, while still retaining the ability to form a normal-appearing skin when combined with dermal fibroblasts in a nude mouse graft assay (W.C. Weinberg, D.L. Morgan and S.H. Yuspa, unpublished data). Thus these cells retain properties of normal basal keratinocytes and provide a useful model to study pre-carcinogenic events.
In order to confirm the genotype of the cells used, p21WAF1/Cip1 mRNA levels were measured by RT–PCR at 24 and 48 h of exposure to 5 µM cisplatin and compared with unexposed cells of the corresponding genotype. As expected there was no p21WAF1/Cip1 mRNA in exposed or unexposed (–/–) cells. In cisplatin-exposed (+/+) and (+/–) cells, at 24 h the cisplatin-induced increases in p21WAF1/Cip1 mRNA levels were similar, at 11.5- and 9.4-fold, respectively. However, at 48 h the 22.3-fold p21WAF1/Cip1 mRNA increase in (+/+) cells was approximately twice the 13.2-fold increase observed in the (+/–) cells (Figure 1). The cisplatin-induced increases in p21WAF1/Cip1 mRNA level were all significant (P 0.05) compared to mRNA levels in the unexposed cells of corresponding genotype (Welch's t-test).
|
) and (+/–) (
) for p21WAF1/Cip1 and subjected to RT–PCR amplification using p21WAF1/Cip1 primers (see Materials and methods). Values shown are mean ± SE for fold-change (n = 4 amplifications).Our original hypothesis was that if p21WAF1/Cip1 participates in the process of DNA repair one would expect to find the least adducts in the (+/+) cells and the most adducts in the (–/–) cells. In order to examine multiple processes that would potentially impact the cisplatin–DNA adduct levels, cells of each genotype were grown to the same degree of confluence (
50%), exposed to cisplatin, harvested at times up to 72 h of exposure and examined for cytotoxicity, cisplatin–DNA adduct formation, cell proliferation, and apoptosis. The medium was not changed during this time and both floating and attached cells were counted at harvest. Cell viability was determined by trypan blue exclusion for 3–4 experiments, that is, cells exposed on 3–4 different occasions. For each experiment the % of viable cells was averaged for 3–4 replicate cultures. There were increases in numbers of untreated cells of all three genotypes for the 72 h duration of this experiment. Comparing the viable cells in the cisplatin-exposed groups to the viable cells in the unexposed groups, cell survival in cisplatin-exposed groups ranged between 60.4 and 73.6% of the unexposed controls at 24 h, and between 22.4 and 41.0% of the unexposed controls at 72 h (Table I).
|
Cisplatin–DNA adduct formation during 72 h of cisplatin exposure
Cisplatin–DNA adduct formation was determined at 0 and 24 h in 6 experiments (Table I and Figure 2), and at 0, 8, 48 and 72 h in 2 experiments (Table I). For each experiment p21WAF1/Cip1 (+/+), (+/–), and (–/–) cells were continuously exposed to 5 µM cisplatin and adducts measured by cisplatin–DNA CIA using triplicate experimental wells and one control well for each sample. Values for cisplatin–DNA adducts were consistently lower in the (+/–) cells, compared to the (+/+) and (–/–) cells at all time points (Figure 2 and Table I). At 24 h, the (+/+) and (–/–) cells had higher Pt DNA adduct levels compared to the (+/–) cells by both the pairwise Student–Newman–Keuls method (P < 0.05 for both comparisons) and the Mann–Whitney rank sum test [(+/–) versus (+/+) and (–/–) versus (+/–), P = 0.002 for both comparisons]. At 48 h, where there were only two experiments; however, Pt-DNA adducts in the (–/–) cells were significantly higher (P = 0.002) compared to Pt-DNA adducts in the (+/–) cells.
|
This unexpected observation was also found at 24 h in three separate experiments performed using an additional set of keratinocytes, W1#1, W3het3,4A and W3KO1A, which were (+/+), (+/–) and (–/–), respectively, for p21WAF1/Cip1 (data not shown; Z. Zhang and M.C. Poirier, unpublished data). Due to insufficient material these cell strains were not used for the experiments presented in this paper.
Cell cycle and apoptosis during 48 h of cisplatin exposure
When flow-cytometry was used to determine the fraction of cisplatin-exposed cells in S-phase, in three separate experiments involving cisplatin exposures on different occasions, a p21WAF1/Cip1-induced cell cycle arrest was observed as expected (3,26). At 24 h, p21WAF1/Cip1 (–/–) cells had 47.4 ± 3.7% (mean ± SE, n = 3) of cells in S-phase compared to 15.3 ± 0.4% (mean ± SE, n = 3) of cells in S-phase for the (+/+) cells. At 24 h the (+/+) cells exposed to cisplatin showed a 51% reduction in cells in S-phase, while the (+/–) and (–/–) cells exposed to cisplatin had S-phase cell reductions of 40 and 11%, respectively (P = 0.04, ANOVA with contrasts comparing the difference in % of cells in S-phase for cisplatin and unexposed cells (+/+) and (–/–) cells). In addition, at 24 h the % of untreated (+/+) cells in S-phase (31.5 ± 6.0, mean ± SE, n = 3) was significantly (P = 0.03, two-sided) different from the % of cisplatin-exposed (+/+) cells in S-phase (15.3 ± 0.4%, mean ± SE, n = 3).
The apoptotic response was determined in two to three separate experiments, and for each experiment four replicate cultures were examined (Table I). Apoptosis was highest in the unexposed (+/+) cells at 24, 48 and 72 h, and increased 
2-fold in the presence of cisplatin.
Gene-dosage effects
Figure 3 shows a comparison of values for % of cells in S-phase, % of cells in apoptosis and cisplatin–DNA adduct levels in (+/+), (+/–) and (–/–) cells at 24 h of exposure to 5 µM cisplatin. The figure shows that cells of each genotype responded differently with respect to the balance between cell cycle arrest, apoptosis and DNA adduct level. The (+/+) cells responded to cisplatin exposure by both inhibiting DNA synthesis and entering apoptosis, while the (+/–) cells had about half the normal cell cycle arrest combined with a negligible apoptotic response, and the (–/–) cells did not show either cell cycle arrest or apoptosis in response to cisplatin exposure. The data, summarized in Figure 3, show that the p21WAF1/Cip1 gene product influences DNA damage-induced cell-cycle arrest and apoptosis, but these events do not completely account for the low levels of Pt-DNA damage in the (+/–) cells.
|
|
Discussion |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
These experiments have demonstrated that cisplatin–DNA adduct levels were lower in p21WAF1/Cip1 (+/–) cells, compared with (+/+) and (–/–) cells, throughout the time course studied (0–72 h), and most particularly at 24 and 48 h. This unexpected finding presents a challenge to the interpretation of underlying events. As the experiments were repeated several times over a period of 24 months by different individuals, it appears likely that the data are correct. Searching for an explanation, we ascertained that cell cycle arrest and apoptosis, occurring in response to cisplatin-induced DNA damage, were also altered by p21WAF1/Cip1 gene dosage in the mouse keratinocyte cells but did not appear to completely account for the differences in Pt-DNA adduct levels.
One possible explanation for these results is that the presence and expression of p21WAF1/Cip1 in mouse keratinocytes is directly or indirectly associated with a DNA adduct processing function, that could presumably either slow the formation of adducts or enhance their removal. What we know is that, in p21WAF1/Cip1 (+/+) cells, which presumably have an intact DNA adduct removal function, cisplatin induced a strong cell cycle arrest and a strong apoptosis response, consistent with previous literature reports (3). In these cells, the arrest of DNA replication would inhibit DNA adduct dilution, but apoptosis would enhance DNA adduct removal, and the hypothetical p21WAF1/Cip1-related DNA adduct removal capacity would presumably be intact. In the cisplatin-exposed (–/–) cells, cisplatin induced neither cell cycle arrest nor appreciable apoptosis, and there was presumably no p21WAF1/Cip1-related DNA adduct removal capacity, so DNA adduct removal in (–/–) cells was primarily accomplished by dilution through DNA replication. The (+/–) cells, with the lowest levels of Pt-DNA adducts, had a partial cell cycle arrest, a partial apoptosis response, and presumably a partial DNA adduct removal function, the combination of which appears to have provided the most efficient overall lowering of cisplatin–DNA adduct levels.
The p21 protein has impressive multifunctionality. It facilitates the assembly of cyclins, cdks, and PCNA (a subunit of DNA polymerase 
) to regulate cell cycle progression and DNA replication (3). p21WAF1/Cip1 cell cycle regulation is particularly important in the presence of DNA damaging agents (e.g. ultraviolet light, X-ray, cisplatin, 7,12-dimethylbenz(a)anthracene), where the p21 protein stops DNA replication by binding to and inhibiting the replicative activity of PCNA, thus allowing DNA repair to occur. The data generated in this study, with respect to cell cycle arrest and apoptosis, are consistent with the known functions of the p21WAF1/Cip1 protein, and the observation that fewer cisplatin–DNA adducts were measurable in the (+/–) cells compared to the (+/+) and (–/–) cells has forced us to consider the role of DNA adduct formation/repair. Whereas the essential role of TP53 in nucleotide excision repair has been documented in multiple studies (6,27,28), the potential role of p21WAF1/Cip1 remains controversial. This is perhaps not surprising as multiple p21WAF1/Cip1 pathways and functions are independent of TP53-induction (3). Reports of the involvement of p21WAF1/Cip1 in the DNA repair process have varied depending on the cell type (tumour or normal), the DNA damaging agent (ultraviolet light, cisplatin, benzo[a]pyrene) and the method of DNA repair assessment (6–15). A summary of the relevant literature reports reveals that three studies (6–8) showed no effect of p21WAF1/Cip1 on nucleotide excision repair, global genomic repair, or transcription-coupled repair; and four studies indicated that p21WAF1/Cip1 facilitates or increases DNA repair (9–11,13). However other studies suggest that p21 protein can inhibit DNA repair when bound to PCNA, the processivity factor for DNA replication, and that removal of p21 from PCNA, and/or degradation of the protein, facilitates gap-filling repair replication (1,9,12,14,15). Many of these DNA repair studies were performed using highly-specific conditions. For example, the use of human colon tumour lines, or cell-free systems with host-cell reactivation-based DNA repair, may yield data different from those obtained with normal cells.
Maeda et al. (26) have performed a study somewhat similar to ours. They employed primary keratinocyte cells from p21WAF1/Cip1 (+/+) and (–/–) mice, and investigated cell cycle arrest, apoptosis and nucleotide excision repair in cultures exposed to ultraviolet B (UVB) irradiation. Much of the data showed distinct similarity to that presented here, for example, in p21WAF1/Cip1 (–/–) cells the abrogation of cell cycle arrest and the decreased apoptosis response in the presence of a DNA damaging agent. In addition, using a UVB dose of 50 J/m2, Maeda et al. (26) found that the removal of thymidine dimers by DNA repair was not detectable during the first 8 h after UVB irradiation in the p21WAF1/Cip1 (–/–) cells, but did proceed during that time in the p21WAF1/Cip1 (+/+) cells, demonstrating an impairment of DNA repair in the p21WAF1/Cip1 (–/–) cells. In the current report, the data suggest that a p21WAF1/Cip1 DNA adduct removal/repair function contributes to cisplatin–DNA adduct processing in normal undifferentiating mouse keratinocytes, however further studies will be required to define clearly the relationship between p21WAF1/Cip1 and DNA repair in these cells.
The influence of epidermal p21WAF1/Cip1 on mouse skin tumour formation induced by DNA damaging agents has been of interest for some time. While mice that are null for p21WAF1/Cip1 are not particularly prone to spontaneous skin or organ tumours (3), the same mice display high-susceptibility to 7,12-dimethylbenz(a)anthracene initiation combined with phorbol ester promotion (29,30). Cisplatin, used extensively in human cancer chemotherapy, is also a skin carcinogen in rodents (31–33) and a known genotoxin. The availability of p21WAF1/Cip1 transgenic mice has provided an opportunity to explore the function of p21WAF1/Cip1 with respect to a putative role in DNA repair and potential protection against cancer. The data show that p21WAF1/Cip1 gene dosage is related to proliferation arrest, apoptosis and an additional DNA adduct removal mechanism, all of which play a role in Pt-DNA adduct removal in normal mouse keratinocytes exposed to cisplatin. We hypothesize that the protection against genotoxin-induced skin tumorigenesis conferred by a functioning p21WAF1/Cip1 gene in the mouse likely involves a balance between cell cycle arrest, apoptosis and a p21WAF1/Cip1-mediated DNA adduct ‘processing’ activity that may include either a reduction in DNA adduct formation or an enhanced DNA adduct repair.
|
Acknowledgments |
|---|
Thanks to Wendy Tseng for assistance with cell line derivation, Roshini M. Ponnamperuma for help with the genotyping and Barbara Taylor for help with the flow-cytometry. We also wish to thank Paul S. Albert, Zhihua Zhang, Wing Quan and Mary Velthuis for statistical, editorial and technical assistance. This work was supported by the Intramural Research Program of the NIH, National Cancer Institute.
|
Notes |
|---|
*To whom correspondence should be addressed at: Carcinogen–DNA Interactions Section, National Cancer Institute, Building 37, Room 4032, NIH, 37 Convent Dr, MSC-4255, Bethesda, MD 20892-4255, USA. Email: poirierm{at}exchange.nih.gov
|
References |
|---|
|
TopIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
-
1. Shivji M.K., Ferrari E., Ball K., Hubscher U., Wood R.D. (1998) Resistance of human nucleotide excision repair synthesis in vitro to p21Cdn1. Oncogene 17:2827–2838.[CrossRef][Web of Science][Medline]
2. el Deiry W.S., Tokino T., Velculescu V.E., Levy D.B., Parsons R., Trent J.M., Lin D., Mercer W.E., Kinzler K.W., Vogelstein B. (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75:817–825.[CrossRef][Web of Science][Medline]
3. Weinberg W.C. and Denning M.F. (2002) P21Waf1 control of epithelial cell cycle and cell fate. Crit. Rev. Oral Biol. Med. 13:453–464.
4. Gartel A.L., Serfas M.S., Tyner A.L. (1996) p21-negative regulator of the cell cycle. Proc. Soc. Exp. Biol. Med. 213:138–149.[CrossRef][Medline]
5. Harper J.W., Adami G.R., Wei N., Keyomarsi K., Elledge S.J. (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805–816.[CrossRef][Web of Science][Medline]
6. Wani M.A., Wani G., Yao J., Zhu Q., Wani A.A. (2002) Human cells deficient in p53 regulated p21(waf1/cip1) expression exhibit normal nucleotide excision repair of UV-induced DNA damage. Carcinogenesis 23:403–410.
7. Adimoolam S., Lin C.X., Ford J.M. (2001) The p53-regulated cyclin-dependent kinase inhibitor, p21 (cip1, waf1, sdi1), is not required for global genomic and transcription-coupled nucleotide excision repair of UV-induced DNA photoproducts. J. Biol. Chem. 276:25813–25822.
8. Wani M.A., El Mahdy M.A., Hamada F.M., Wani G., Zhu Q., Wang Q.E., Wani A.A. (2002) Efficient repair of bulky anti-BPDE DNA adducts from non-transcribed DNA strand requires functional p53 but not p21(waf1/cip1) and pRb. Mutat. Res. 505:13–25.[Web of Science][Medline]
9. Stivala L.A., Riva F., Cazzalini O., Savio M., Prosperi E. (2001) p21(waf1/cip1)-null human fibroblasts are deficient in nucleotide excision repair downstream the recruitment of PCNA to DNA repair sites. Oncogene 20:563–570.[CrossRef][Web of Science][Medline]
10. Smith M.L., Ford J.M., Hollander M.C., Bortnick R.A., Amundson S.A., Seo Y.R., Deng C.X., Hanawalt P.C., Fornace A.J. Jr. (2000) p53-mediated DNA repair responses to UV radiation: studies of mouse cells lacking p53, p21, and/or gadd45 genes. Mol. Cell. Biol. 20:3705–3714.
11. Fan S., Chang J.K., Smith M.L., Duba D., Fornace A.J. Jr, O'Connor P.M. (1997) Cells lacking CIP1/WAF1 genes exhibit preferential sensitivity to cisplatin and nitrogen mustard. Oncogene 14:2127–2136.[CrossRef][Web of Science][Medline]
12. Pan Z.Q., Reardon J.T., Li L., Flores-Rozas H., Legerski R., Sancar A., Hurwitz J. (1995) Inhibition of nucleotide excision repair by the cyclin-dependent kinase inhibitor p21. J. Biol. Chem. 270:22008–22016.
13. McDonald E.R. III, Wu G.S., Waldman T., el Deiry W.S. (1996) Repair Defect in p21 WAF1/CIP1 -/- human cancer cells. Cancer Res. 56:2250–2255.
14. Cooper M.P., Balajee A.S., Bohr V.A. (1999) The C-terminal domain of p21 inhibits nucleotide excision repair in vitro and in vivo. Mol. Biol. Cell 10:2119–2129.
15. Bendjennat M., Boulaire J., Jascur T., Brickner H., Barbier V., Sarasin A., Fotedar A., Fotedar R. (2003) UV irradiation triggers ubiquitin-dependent degradation of p21(WAF1) to promote DNA repair. Cell 114:599–610.[CrossRef][Web of Science][Medline]
16. Johnson S.W., Stevenson J.P., O'Dwyer P.J. (2001) Cisplatin and its analogues. In DeVita V.T., Hellman S., Rosenberg S.A. (Eds.). Cancer Principles & Practice of Oncology(Lippincott Williams & Wilkins, Philadelphia) pp. 376.
17. Zhang Z. and Poirier M.C. (1997) Cisplatin-DNA adduct determination in the hepatic albumin gene as compared to whole genomic DNA. Chem. Res. Toxicol. 10:971–977.[CrossRef][Web of Science][Medline]
18. Deng C., Zhang P., Harper J.W., Elledge S.J., Leder P. (1995) Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control. Cell 82:675–684.[CrossRef][Web of Science][Medline]
19. Weinberg W.C., Montano N.E., Deng C. (1997) Loss of p21CIP1/WAF1 does not recapitulate accelerated malignant conversion caused by p53 loss in experimental skin carcinogenesis. Oncogene 15:685–690.[CrossRef][Web of Science][Medline]
20. Azzoli C.G., Sagar M., Wu A., Lowry D., Hennings H., Morgan D.L., Weinberg W.C. (1998) Cooperation of p53 loss of function and v-Ha-ras in transformation of mouse keratinocyte cell lines. Mol. Carcinog. 21:50–61.[CrossRef][Web of Science][Medline]
21. Dlugosz A.A., Glick A.B., Tennenbaum T., Weinberg W.C., Yuspa S.H. (1995) Isolation and utilization of epidermal keratinocytes for oncogene research. Methods Enzymol. 254:3–20.[Web of Science][Medline]
22. Divi R.L., Beland F.A., Fu P.P., Von Tungeln L.S., Schoket B., Camara J., Rothman N., Sinha R., Poirier M.C. (2002) Highly-sensitive chemiluminescence immunoassay for benzo(a)pyrene-DNA adducts: validation by comparison with other methods, and use in human biomonitoring. Carcinogenesis 12:2043–2049.
23. Divi R.L., Osborne M.R., Hewer A., Phillips D.H., Poirier M.C. (1999) Tamoxifen-DNA adduct formation in rat liver determined by immunoassay and 32P-postlabeling. Cancer Res. 59:4829–4833.
24. Giurgiovich A.J., Diwan B.A., Lee K.B., Anderson L.M., Rice J.M., Poirier M.C. (1996) Cisplatin-DNA adduct formation in maternal and fetal rat tissues after transplacental cisplatin exposure. Carcinogenesis 17:1665–1669.
25. Shamkhani H., Anderson L.M., Henderson C.E., Moskal T.J., Runowicz C.D., Dove L.F., Jones A.B., Chaney S.G., Rice J.M., Poirier M.C. (1994) DNA adducts in human and patas monkey maternal and fetal tissues induced by platinum drug chemotherapy. Reprod. Toxicol. 8:207–216.[CrossRef][Web of Science][Medline]
26. Maeda T., Chong M.T., Espino R.A., Chua P.P., Cao J.Q., Chomey E.G., Luong L., Tron V.A. (2002) Role of p21WAF1 in regulating the G1 and G2/M checkpoints in ultraviolet irradiated keratinocytes. J. Invest. Dermatol. 119:513–521.[CrossRef][Web of Science][Medline]
27. Hwang B.J., Ford J.M., Hanawalt P.C., Chu G. (1999) Expression of the p48 xeroderma pigmentosum gene is p53-dependent and is involved in global genomic repair. Proc. Natl Acad. Sci. USA 96:424–428.
28. Ford J.M. and Hanawalt P.C. (1997) Expression of wild-type p53 is required for efficient global genomic nucleotide excision repair in UV-irradiated human fibroblasts. J. Biol. Chem. 272:28073–28080.
29. Weinberg W.C., Fernandez-Salas E., Morgan D.L., Shalizi A., Mirosh E., Stanulis E., Deng C., Hennings H., Yuspa S.H. (1999) Genetic deletion of p21WAF1 enhances papilloma formation but not malignant conversion in experimental mouse skin carcinogenesis. Cancer Res. 59:2050–2054.
30. Topley G.I., Okuyama R., Gonzales J.G., Conti C., Dotto G.P. (1999) p21(WAF1/Cip1) functions as a suppressor of malignant skin tumor formation and a determinant of keratinocyte stem-cell potential. Proc. Natl Acad. Sci. USA 96:9089–9094.
31. Barnhart K.M. and Bowden G.T. (1985) Cisplatin as an initiating agent in two-stage mouse skin carcinogenesis. Cancer Lett. 29:101–105.[CrossRef][Web of Science][Medline]
32. Leopold W.R., Miller E.C., Miller J.A. (1979) Carcinogenicity of antitumor cis-platinum (II) coordination complexes in the mouse and rat. Cancer Res. 39:913–918.
33. Hennings H., Shores R.A., Poirier M.C., Reed E., Tarone R.E., Yuspa S.H. (1990) Enhanced malignant conversion of benign mouse skin tumors by cisplatin. J. Natl Cancer Inst. 82:836–840.
Received on August 1, 2006; revised on September 13, 2006; accepted on October 2, 2006.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||